View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5585_low_1 (Length: 878)
Name: NF5585_low_1
Description: NF5585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5585_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 419; Significance: 0; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 419; E-Value: 0
Query Start/End: Original strand, 433 - 859
Target Start/End: Complemental strand, 46901506 - 46901080
Alignment:
| Q |
433 |
gcccacgttttcattgagcctagcagccgcagcaacagaagcagctacaccaccaggagtagcagtagcatcaggattattcctcatctcagcactagcc |
532 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901506 |
gcccacgttttcattgagcctagcagccgcagcaacagaagcagctacaccaccaggagtagcagtagcatcaggattattcctcatctcagcactagcc |
46901407 |
T |
 |
| Q |
533 |
accccagcagcatcttgccttgtcgccgccttatcagctggcagcttcgctgttgctccggtcagaacatctcccatcttaatcttctcctcctcacgtt |
632 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901406 |
accccagcagcatcttgccttgtcgccgccttatcagctggcagcttcgctgttgctccggtcagaacatctcccatcttaatcttctcctcctcacgtt |
46901307 |
T |
 |
| Q |
633 |
gacactcagcattgaaagctgctgcagattgagccattgaagccaaacctcccggtgttataatattactccccgtagctctcacctccgccgcttgtat |
732 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901306 |
gacactcagcattgaaagctgctgcagattgagccattgaagccaaacctcccggtgttataacattactccccgtagctctcacctccgccgcttgtat |
46901207 |
T |
 |
| Q |
733 |
cgcagaggcgtcactctgttccaccggcttgtcacccaccgtgtgggccgtcgcctctagtgcctctccgatggttaatgcactctctcgaaccgcaccg |
832 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901206 |
cgcagaggcgtcactctgttccaccggcttgtcgcccaccgtgtgggccgtcgcctctagtgcctctccgatggttaatgcactctctcgaaccgcaccg |
46901107 |
T |
 |
| Q |
833 |
gttagaccaacttgaactggagtcggt |
859 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
46901106 |
gttagaccaacttgaactggagtcggt |
46901080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 45 - 126
Target Start/End: Complemental strand, 46902121 - 46902040
Alignment:
| Q |
45 |
atggagtgggattggctgggatcaatttggtttgcttctccttttggaatcaccttccaatacatgagtctaaaaacatgag |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46902121 |
atggagtgggattggctgggatcaatttggtttgcttctccttttggaatcaccttccaatacatgagtctaaaaacatgag |
46902040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 119 - 209
Target Start/End: Complemental strand, 46902019 - 46901929
Alignment:
| Q |
119 |
aacatgaggtatggttgcgtttagttccagcagcagaacaataatatctgcatgggagcgattgttcaagatttgcttgatgaatttattt |
209 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46902019 |
aacaggaggtatggttgcatttagttccagcacaagaacaataatatctgcatgggagcgattgttcaagatttgcttgatgaatttattt |
46901929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 46901713 - 46901663
Alignment:
| Q |
223 |
tatagatataattgacaagtgaaaaccattttcaattaagagcacaacata |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46901713 |
tatagatataattgacaagtgaaaaccattttcaatcaagagcacaacata |
46901663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University