View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5585_low_21 (Length: 300)
Name: NF5585_low_21
Description: NF5585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5585_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 10 - 284
Target Start/End: Original strand, 27312607 - 27312881
Alignment:
| Q |
10 |
ctaaaacatattctgcaccaacacggtcaagatcaacaggattcttatctattctcttgttatcacggtcaaactcaacaggtgtgttggtgcaaccagg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27312607 |
ctaaaacatattctgcaccaacacggtcaagatcaacaggattcttatctattctcttgttatcacggtcaaactcaacaggtgtgttggtgcaaccagg |
27312706 |
T |
 |
| Q |
110 |
tgaggattgtgagaggtttacattgagattacccgataaagttcgaaagcagatgatgatgaacacgacgacgcttaagcgtgcaaaaagttgtgtaagt |
209 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27312707 |
tgaggattgtgagaggtttacactgaggttacccgataaagttcgaaagcagatgatgttgaacacgacgacacttaagcgtgcaaaaagttgtgtaagt |
27312806 |
T |
 |
| Q |
210 |
tttacgagaatgagcagtggcacgtgcggatataggtcaagaagttttggttgtggaagtgggattggtcaagtg |
284 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27312807 |
tttacgagaatgagcagtggcacgttcggatataggtcaagaagttttggttgtggaagtgggattggtcaagtg |
27312881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University