View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5585_low_23 (Length: 269)
Name: NF5585_low_23
Description: NF5585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5585_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 46 - 253
Target Start/End: Original strand, 40513587 - 40513795
Alignment:
| Q |
46 |
tgttcatccttttatcatagtatataactatcaaagccatatatcattccttaaaaatattttcgaaccgatc--ataggttttgttaaatatcccaaag |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
40513587 |
tgttcatccttttatcatagtatataactatcaaagc-atatatcattccttaaaaatattttcgaaccgatctcataggttttgtcaaatatcccaaag |
40513685 |
T |
 |
| Q |
144 |
atgagcatgctaacttgactcaacctagtagctacctaaactttaatttggctccgcattgggattttagatattatatatacttatatcaaaatgggat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40513686 |
atgagcatgctaacttgactcaacctagtagctacctaaactttaatttggctccgcattgggattttagatattatatatacctatatcaaaatgggat |
40513785 |
T |
 |
| Q |
244 |
actaagttat |
253 |
Q |
| |
|
|||||||||| |
|
|
| T |
40513786 |
actaagttat |
40513795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University