View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5585_low_32 (Length: 240)
Name: NF5585_low_32
Description: NF5585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5585_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 35455031 - 35455240
Alignment:
| Q |
18 |
atggaaaagttaattgcacatagaaatcagagagtaaattagcaaggatgagaaaactatgtcaaagacaatgatgggaatgtaacaatatcatcatttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35455031 |
atggaaaagttaattgcacatagaaatcacagagtaaattagcaaggatgagaaaactatgtcaaagacaatgatgggaatgtaacaatatcatcctttt |
35455130 |
T |
|
| Q |
118 |
tcttcttatatgc-ttgcaaaaagatgttcaagatgatgagcatggaacaaggaggatatggaaaattacaaaatacaccttcttgtattgtcacatgtc |
216 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35455131 |
tcttcttatatgctttgcaaaaagatgttcaagatgatgagcatggaacaaggaggatatggaaaattacaaaatacaccttcttgtattgtcacatgtc |
35455230 |
T |
|
| Q |
217 |
tatttaatgc |
226 |
Q |
| |
|
|||||||||| |
|
|
| T |
35455231 |
tatttaatgc |
35455240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University