View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5587-Insertion-4 (Length: 145)
Name: NF5587-Insertion-4
Description: NF5587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5587-Insertion-4 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 1e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 6 - 145
Target Start/End: Original strand, 47506752 - 47506891
Alignment:
| Q |
6 |
cacaaatcccaatgctttgactgtccctttctcttctcttgctgctattcattcaaatttgtcactcccgaaacccacggggcagtgtgctcacatggat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47506752 |
cacaaatcccaatgctttgactgtccctttctcttctcttgctgctattcattcaaatttgtcactcccgaaacccacggggcagtgtgctcacatggat |
47506851 |
T |
 |
| Q |
106 |
gaagtgagtatccaccattattaacataaccttgctggtg |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47506852 |
gaagtgagtatccaccattattaacataaccttgctggtg |
47506891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University