View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5587_low_18 (Length: 287)
Name: NF5587_low_18
Description: NF5587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5587_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 5713153 - 5713372
Alignment:
| Q |
1 |
acataccatcgaagttctgcagtggtctatctcttcaactggggtttatctctaactctttcaagtgaagttaccaaattcttatcaagtttaatgtaga |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
5713153 |
acataccattgaagttctgcagtggtctatctcttcaactggggtttatctctaattctttcaagtgaagttac-aaatttttatcaagtttaatgtaga |
5713251 |
T |
 |
| Q |
101 |
tcaatatcatgggcaacagtggaattgagaggggatgctctgaattctacggcggtggttttcatgtaaatggagcaaccagaatgtgacacggtcgact |
200 |
Q |
| |
|
| | ||||||||| |||||||||||||||| ||| |||||| |||||||||||||||||||||||||||| |||| |||||||||||||||| ||||||| |
|
|
| T |
5713252 |
ttagtatcatgggaaacagtggaattgagaaggggtgctctcaattctacggcggtggttttcatgtaaaaggagtaaccagaatgtgacactgtcgact |
5713351 |
T |
 |
| Q |
201 |
tttgaaaagttaccgctcaaa |
221 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
5713352 |
tttgaaaagttaccactcaaa |
5713372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University