View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5587_low_21 (Length: 271)
Name: NF5587_low_21
Description: NF5587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5587_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 9 - 254
Target Start/End: Complemental strand, 12886665 - 12886420
Alignment:
| Q |
9 |
ccaattcttatccctcaatcctcaccatgcctcctccattgacgctattgtttgtaccggaggctacaccgtcaatgctgatgttctccaacttctcccc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12886665 |
ccaattcttatccctcaatcctcaccatgcctcctccattgccgctattgtttgtaccggaggctacaccgtcaacgctgatgttctccaacttctcccc |
12886566 |
T |
|
| Q |
109 |
tccctccgtcttgtctgcacccccagcgccggaactgatcatattgatctctccgagtgtcggcgtcggggaattcaggttgcaggagctggaaatcttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12886565 |
gccctccgtcttgtctgcacccccagcgctggaactgatcatattgatctctccgagtgtcggcgtcggggaattcaggttgcaggagctggaaatcttt |
12886466 |
T |
|
| Q |
209 |
tttctgaagatgttgctgatatggctgttgctttgttgattgatgt |
254 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
12886465 |
tttctgaagatgtggcggatatggctgttgctttgttgattgatgt |
12886420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 126 - 256
Target Start/End: Complemental strand, 12899418 - 12899288
Alignment:
| Q |
126 |
cacccccagcgccggaactgatcatattgatctctccgagtgtcggcgtcggggaattcaggttgcaggagctggaaatcttttttctgaagatgttgct |
225 |
Q |
| |
|
|||| |||||||||||||| |||| ||||||||| ||||||||||| |||||||| |||||||| |||||||||||||| || || ||||||||| |
|
|
| T |
12899418 |
cacctccagcgccggaactaatcacattgatctcgatgagtgtcggcgacggggaatccaggttgctaacgctggaaatcttttctccgaggatgttgct |
12899319 |
T |
|
| Q |
226 |
gatatggctgttgctttgttgattgatgttg |
256 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |
|
|
| T |
12899318 |
gatatggctgtggctttgttgattgatgttg |
12899288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University