View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5587_low_25 (Length: 256)
Name: NF5587_low_25
Description: NF5587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5587_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 248
Target Start/End: Complemental strand, 44774512 - 44774282
Alignment:
| Q |
18 |
ctatcagatatgggtatatgcgccattgatgagtttgacaagatggatgaatcagatcgtacatctatacacgaagttatggaacaacagactgttagca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44774512 |
ctatcagatatgggtatatgcgccattgatgagtttgacaagatggatgaatcagatcgtacatctatacacgaagttatggaacaacagactgttagca |
44774413 |
T |
 |
| Q |
118 |
ttgccaaggctgggatcactacatcgctgaatgctaggactgctgtccttgctgcagctaatccagcatggtattaattattttcaccttattgatggga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44774412 |
ttgccaaggctgggatcactacatcgctgaatgctaggactgctgtccttgctgcagctaatccagcatggtattaattattttcaccttattgatggga |
44774313 |
T |
 |
| Q |
218 |
tacaagatctcattgccatgcattctgtgct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44774312 |
tacaagatctcattgccatgcattctgtgct |
44774282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University