View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5587_low_29 (Length: 249)
Name: NF5587_low_29
Description: NF5587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5587_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 14 - 128
Target Start/End: Original strand, 4704790 - 4704904
Alignment:
| Q |
14 |
ttctagttggaaaagtttgactctttaagtttgttatgataattgataactatggttgatgttttgagctatctttattcttggtcatgattggttgtta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4704790 |
ttctagttggaaaagtttgactctttaagtttgttgtgataattgataactatggttgatgttttgagctatctttattcttggtcatgattggttgtta |
4704889 |
T |
|
| Q |
114 |
taaatactaatagcc |
128 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4704890 |
caaatactaatagcc |
4704904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 198 - 234
Target Start/End: Original strand, 4704977 - 4705013
Alignment:
| Q |
198 |
cttagtgataaagttgtagccttttaagttttgatga |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4704977 |
cttagtgataaagttgtagtcttttaagttttgatga |
4705013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University