View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5587_low_30 (Length: 248)
Name: NF5587_low_30
Description: NF5587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5587_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 47 - 239
Target Start/End: Complemental strand, 43975157 - 43974972
Alignment:
| Q |
47 |
cttgtgtagatgtactatcaacgacctggcatggaacttgtttgattctgaaggagaaacaacgtcaagattcgtcgatgtccaatgctgaatttggata |
146 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43975157 |
cttgtgtagatgtactatcaaccacccggcatggaacttttttgattctgaaggagaaacaacgtcaagattcgtcgatgtccaatgctgaatttggata |
43975058 |
T |
|
| Q |
147 |
tatttttgggttttttactttaacaaaaggcacgagtagagagaataaagatgcttccaagttccaacgacttcctcctaccaaccttgcctt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
43975057 |
tatttttgggttttttactttaacaaaaggcacgagtagagagaataaagatgctt-------ccaacgacttcctcctaccaaccttacctt |
43974972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University