View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5587_low_35 (Length: 238)
Name: NF5587_low_35
Description: NF5587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5587_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 20135717 - 20135940
Alignment:
| Q |
1 |
aggtgtcagcaaaccagaggcatcatcaacgaaacatactactgatctggaaggacacggggacagtgtgtctcatcaacgcaatcagctgtttc-aaaa |
99 |
Q |
| |
|
|||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
20135717 |
aggtgtcagcaaaccaaaggcattaccaacgaaacatactactgatctggaaggacacggggacagtgtgtctcatcaatgcaatcagctgtttcaaaaa |
20135816 |
T |
|
| Q |
100 |
aactgttttggaaccggtagccatnnnnnnnncagcagcaactgatatttctgttagtaaatttttggaacctgaagcgccaaaaaattctgcagcagct |
199 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20135817 |
aactgttttggaaccggtagccataaaaaaaacagcagcaactgatatttctgttagtaaatttttggaacctgaagcgccaaaaaattctgcagcagct |
20135916 |
T |
|
| Q |
200 |
gatgttcatgtagcgctaaaaaat |
223 |
Q |
| |
|
||||||||||||| |||||||||| |
|
|
| T |
20135917 |
gatgttcatgtagtgctaaaaaat |
20135940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 134 - 223
Target Start/End: Original strand, 20136001 - 20136090
Alignment:
| Q |
134 |
gcagcaactgatatttctgttagtaaatttttggaacctgaagcgccaaaaaattctgcagcagctgatgttcatgtagcgctaaaaaat |
223 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||| | ||| ||||||| ||| ||||||||| ||||||||||| ||||||||| |
|
|
| T |
20136001 |
gcagcagctgatgtttctgttagtaaatttttggaacctgtaacgctaaaaaatactggagcagctgaggttcatgtagcactaaaaaat |
20136090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 44356354 - 44356131
Alignment:
| Q |
1 |
aggtgtcagcaaaccagaggcatcatcaacgaaacatactactgatctggaaggacacggggacagtgtgtctcatcaacgcaatcagctgtttcaa-aa |
99 |
Q |
| |
|
|||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
44356354 |
aggtgtcagcaaaccaaaggcattaccaacgaaacatactactgatctggaaggacacggggacagtgtgtctcatcaatgcaatcagctgtttcaaaaa |
44356255 |
T |
|
| Q |
100 |
aactgttttggaaccggtagccatnnnnnnnncagcagcaactgatatttctgttagtaaatttttggaacctgaagcgccaaaaaattctgcagcagct |
199 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44356254 |
aactgttttggaaccggtagccataaaaaaaacagcagcaactgatatttctgttagtaaatttttggaacctgaagcgccaaaaaattctgcagcagct |
44356155 |
T |
|
| Q |
200 |
gatgttcatgtagcgctaaaaaat |
223 |
Q |
| |
|
||||||||||||| |||||||||| |
|
|
| T |
44356154 |
gatgttcatgtagtgctaaaaaat |
44356131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 134 - 223
Target Start/End: Complemental strand, 44356070 - 44355981
Alignment:
| Q |
134 |
gcagcaactgatatttctgttagtaaatttttggaacctgaagcgccaaaaaattctgcagcagctgatgttcatgtagcgctaaaaaat |
223 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||| | ||| ||||||| ||| ||||||||| ||||||||||| ||||||||| |
|
|
| T |
44356070 |
gcagcagctgatgtttctgttagtaaatttttggaacctgtaacgctaaaaaatactggagcagctgaggttcatgtagcactaaaaaat |
44355981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University