View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5587_low_37 (Length: 237)
Name: NF5587_low_37
Description: NF5587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5587_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 4705038 - 4705260
Alignment:
| Q |
1 |
atgttaacatatcagttatgtatccgcgtgaacttaactcagttggccgggataatacatattagatgcagggtgggggaatatatcagctatgttagta |
100 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4705038 |
atgttaacatatcagttgtgtatctgcgtgaacttaactcagttggtaggaataatgcatattagatgcagggtgggggaatatatcagctatgttagta |
4705137 |
T |
 |
| Q |
101 |
tttttcttgtttaccactttatattatgataattaataattatgtctgtgttttggatatttcagtggtcatggaagcttttcaaacaatcccaagctga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4705138 |
tttttcttgtttaccactttatattatgataattaataattatgtctgtgttttggatatttcagtggtcatggaagcttttcaaacaatccaaagctga |
4705237 |
T |
 |
| Q |
201 |
acagtgttgcggggcatttgctg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4705238 |
acagtgttgcggggcatttgctg |
4705260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 20 - 73
Target Start/End: Original strand, 7388450 - 7388503
Alignment:
| Q |
20 |
gtatccgcgtgaacttaactcagttggccgggataatacatattagatgcaggg |
73 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||| | ||||||| |||||||| |
|
|
| T |
7388450 |
gtatccccgtgaacttaactcagttggtagggatattgcatattatatgcaggg |
7388503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University