View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5587_low_38 (Length: 210)

Name: NF5587_low_38
Description: NF5587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5587_low_38
NF5587_low_38
[»] chr7 (1 HSPs)
chr7 (17-192)||(32959482-32959657)


Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 192
Target Start/End: Original strand, 32959482 - 32959657
Alignment:
17 atatgtaaggaaataagtagccagaaatagaatgtgcaacatatataacattatgattcaatgtttcaagatattatccaaaattaatgaaattcagtgt 116  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||    
32959482 atatgtaaggaaataagtaaccagaaatagaatgtgcaacatatataacattatgattcaatgttacaagatattatccaaaattaataaaattcagtgt 32959581  T
117 ttcaagacctttactctttccattctctatgcaccaactctcgttccttctcccctttacggcccagaggaccata 192  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32959582 ttcaagaccttttctctttccattctctatgcaccaactctcgttccttctcccctttacggcccagaggaccata 32959657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University