View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5588-Insertion-10 (Length: 127)
Name: NF5588-Insertion-10
Description: NF5588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5588-Insertion-10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 7 - 116
Target Start/End: Complemental strand, 38568723 - 38568614
Alignment:
| Q |
7 |
aaaatcagcatggataaaaccaggtggttgttgcatgtaaacctcttcacttatttaaccttgcaagaagacattattgacatctagttgatggaaagac |
106 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38568723 |
aaaatcagcatggataaaaccagatggttgttgcatgtaaacctcttcacttatttaaccttgcaagaagacattattgacatctagttgatggaaagac |
38568624 |
T |
 |
| Q |
107 |
catccagagg |
116 |
Q |
| |
|
|||||||||| |
|
|
| T |
38568623 |
catccagagg |
38568614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 28; Significance: 0.0000006; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 16 - 55
Target Start/End: Complemental strand, 3543018 - 3542979
Alignment:
| Q |
16 |
atggataaaaccaggtggttgttgcatgtaaacctcttca |
55 |
Q |
| |
|
|||||||||||| || ||||||||||||||||| |||||| |
|
|
| T |
3543018 |
atggataaaacctggaggttgttgcatgtaaacttcttca |
3542979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 34696746 - 34696785
Alignment:
| Q |
16 |
atggataaaaccaggtggttgttgcatgtaaacctcttca |
55 |
Q |
| |
|
|||||||||||| || ||||||||||||||||| |||||| |
|
|
| T |
34696746 |
atggataaaacctggaggttgttgcatgtaaacttcttca |
34696785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University