View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5588-Insertion-8 (Length: 171)
Name: NF5588-Insertion-8
Description: NF5588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5588-Insertion-8 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 9 - 171
Target Start/End: Complemental strand, 30809224 - 30809062
Alignment:
| Q |
9 |
tttttgccattcaggcagtttgttgtcgttccttcatgaatnnnnnnnnctttcgagaatatatatgaaaagttggaaactatgaaggtnnnnnnnngtc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30809224 |
tttttgccattcaggcagtttgttgtcgttccttcatgaataaaaaaaactttagagaatatatatgaaaagttggaaactatgaaggtaaaaaaaagtc |
30809125 |
T |
|
| Q |
109 |
tgttacccgagtttgggacacacagatccaaccatatacgtgtccatctagtcagaaccctcc |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30809124 |
tgttacccgagtttgggacacacagatccaaccatatacgtgtccatctagtcagaaccctcc |
30809062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 157
Target Start/End: Complemental strand, 30820895 - 30820847
Alignment:
| Q |
109 |
tgttacccgagtttgggacacacagatccaaccatatacgtgtccatct |
157 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | || |||| ||||||| |
|
|
| T |
30820895 |
tgttacccgagtttgggacactcagatccaagcgtacacgtatccatct |
30820847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University