View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5588-Insertion-9 (Length: 205)
Name: NF5588-Insertion-9
Description: NF5588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5588-Insertion-9 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 8 - 205
Target Start/End: Original strand, 37290129 - 37290333
Alignment:
| Q |
8 |
gaaagcccaatcgaagttatttcagaagagttatattataaccaataacc-------aaccctaagcttcttcctcaactcctctatccccaaacaagtt |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
37290129 |
gaaagcccaattgaagttatttcagaagagttatataataaccaataaccaacaaccaaccctaagcttcttcctcaactcctttatccccaaaccagtt |
37290228 |
T |
|
| Q |
101 |
cccttcccactgtttcaggtcacaaatcaatcatccgatcttcaaccatggcttcaagaaagtccgataaccctcactccggcgacggcgccagtcccgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37290229 |
cccttcccactgtttcaggtcacaaatcaatcatccgatcttcaaccatggcttcaagaaagtccgataaccctcactccggcgacggcgccagtcccgg |
37290328 |
T |
|
| Q |
201 |
gttcg |
205 |
Q |
| |
|
||||| |
|
|
| T |
37290329 |
gttcg |
37290333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University