View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5588_high_12 (Length: 283)
Name: NF5588_high_12
Description: NF5588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5588_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 3157567 - 3157302
Alignment:
| Q |
1 |
cccacgtttttcatccccattcctggtggtgtctttatttgtgctcaattatgttgatgttttctatatgatggctcatgggttcaaaattaccttgatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3157567 |
cccacgtttttcatccccattcctggtggtgtctttatttgtgctcaattatgttgatgttt-ctatatgatagctcatgggttcaaaattaccttgatg |
3157469 |
T |
|
| Q |
101 |
aatagtgcttttttcttttgtcccttttaccaaaaattaatgatatttgtctctttgtaaaaaagtatactgttctttttcctcnnnnnnngaataattt |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3157468 |
aatagtgctttttttttttgtcccttttaccaaaaattaatgatatttgtctctttgtaaaaaagtatactgttctttttcctctttttttgaataattt |
3157369 |
T |
|
| Q |
201 |
tacaaaatggggacatcacttgaaccaaaatagggagtactgataaataatgtaggtctggttgttt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3157368 |
tacaaaatggggacatcacttgaaccaaaatagggagtactaataaataatgtaggtctggttgttt |
3157302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 3158043 - 3157986
Alignment:
| Q |
1 |
cccacgtttttcatccccattcctggtggtgtctttatttgtgctcaattatgttgat |
58 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||| ||||||||||| |
|
|
| T |
3158043 |
cccacgtttttcatccccattccgggtggtgtctttattcttgctctattatgttgat |
3157986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University