View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5588_high_17 (Length: 244)
Name: NF5588_high_17
Description: NF5588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5588_high_17 |
 |  |
|
| [»] chr7 (15 HSPs) |
 |  |
|
| [»] chr4 (16 HSPs) |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |
|
| [»] chr5 (37 HSPs) |
 |  |
|
| [»] scaffold0252 (1 HSPs) |
 |  |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
| [»] scaffold1536 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0750 (1 HSPs) |
 |  |  |
|
| [»] scaffold0347 (1 HSPs) |
 |  |  |
|
| [»] scaffold0225 (1 HSPs) |
 |  |  |
|
| [»] scaffold0393 (1 HSPs) |
 |  |  |
|
| [»] scaffold0184 (1 HSPs) |
 |  |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |  |
|
| [»] scaffold1665 (1 HSPs) |
 |  |  |
|
| [»] scaffold0740 (1 HSPs) |
 |  |  |
|
| [»] scaffold0260 (1 HSPs) |
 |  |  |
|
| [»] scaffold0235 (1 HSPs) |
 |  |  |
|
| [»] scaffold0134 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold1648 (1 HSPs) |
 |  |  |
|
| [»] scaffold0061 (1 HSPs) |
 |  |  |
|
| [»] scaffold0017 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 15)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 47 - 244
Target Start/End: Original strand, 16440573 - 16440770
Alignment:
| Q |
47 |
ggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtctt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16440573 |
ggatacggatctcacagggacgctcagggatcgttggattgatccaagctcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtctt |
16440672 |
T |
 |
| Q |
147 |
gaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaaactcctctactctcgcctc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||||||| ||||||| |||||||||| |
|
|
| T |
16440673 |
gaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcacttccaccaaatctttatctctctaagctcctcttctctcgcctc |
16440770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 47 - 244
Target Start/End: Original strand, 16455475 - 16455673
Alignment:
| Q |
47 |
ggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgca-ggggattggaccggtct |
145 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16455475 |
ggatacggatctcacagagacgctcagggttcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaaggggattggaccggtct |
16455574 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaaactcctctactctcgcctc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
16455575 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccgatttattcacttgcaccaaatctttctctctctaagctcctcttctctcgcctc |
16455673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 16161838 - 16161653
Alignment:
| Q |
18 |
taggcccaaacccaaagcccacactcaaaggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
16161838 |
taggcccaaacccaaagcccacactcaatggatacggatctcacagggacgctcagggatcgttggattgatccaagaccccaaaccctagatctaaggg |
16161739 |
T |
 |
| Q |
118 |
ctcacaacgcaggggattggaccggtcttgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttg |
203 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |||| |||||||||| |||||||| |
|
|
| T |
16161738 |
ctcacaacgcagggaattggaccggtcttgaaccggtccggtctaacgctctatataaaaccctagcgcgccggttttttcatttg |
16161653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 52 - 176
Target Start/End: Complemental strand, 17242362 - 17242238
Alignment:
| Q |
52 |
cggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtcttgaacc |
151 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |||||||||||||||||||||| |
|
|
| T |
17242362 |
cggatctcacaggaactctcagggatcgttggattgatccaagatcccaaaccctagatctaagggctcacaacacatgggattggaccggtcttgaacc |
17242263 |
T |
 |
| Q |
152 |
ggtccggtctagcgctctatataaa |
176 |
Q |
| |
|
|||||||| |||| ||||||||||| |
|
|
| T |
17242262 |
ggtccggtttagcactctatataaa |
17242238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 78 - 111
Target Start/End: Original strand, 5802941 - 5802974
Alignment:
| Q |
78 |
cgttggattgatccaagatcccaaaccctagatc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5802941 |
cgttggattgatccaagatcccaaaccctagatc |
5802974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 78 - 114
Target Start/End: Complemental strand, 23764252 - 23764216
Alignment:
| Q |
78 |
cgttggattgatccaagatcccaaaccctagatctaa |
114 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23764252 |
cgttggattgatccaagatgccaaaccctagatctaa |
23764216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 114
Target Start/End: Complemental strand, 7368385 - 7368335
Alignment:
| Q |
64 |
ggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaa |
114 |
Q |
| |
|
|||||| |||| | |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
7368385 |
ggacgcacaggaaccgttagattgatccaagatgccaaaccctagatctaa |
7368335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 121
Target Start/End: Complemental strand, 15853428 - 15853378
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||||| ||||||||||||| | || |||||||||||||||||||||||| |
|
|
| T |
15853428 |
cagggagcgttggattgatctaggaaaccaaaccctagatctaaaggctca |
15853378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 121
Target Start/End: Complemental strand, 16036074 - 16036024
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||||| | ||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
16036074 |
cagggagcattggattgatccaggaagccaaaccctagatctaaaggctca |
16036024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 121
Target Start/End: Complemental strand, 16050798 - 16050748
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||||| | ||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
16050798 |
cagggagcattggattgatccaggaagccaaaccctagatctaaaggctca |
16050748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 23831981 - 23832010
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23831981 |
gggattggaccggtcttgaaccggtccggt |
23832010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 159
Target Start/End: Original strand, 10922465 - 10922501
Alignment:
| Q |
123 |
aacgcaggggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
10922465 |
aacgaaggggattggaccggtcttggaccggtccggt |
10922501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 159
Target Start/End: Original strand, 16499593 - 16499629
Alignment:
| Q |
123 |
aacgcaggggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
16499593 |
aacgaaggggattggaccggtcttggaccggtccggt |
16499629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 159
Target Start/End: Original strand, 16508888 - 16508924
Alignment:
| Q |
123 |
aacgcaggggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
16508888 |
aacgaaggggattggaccggtcttggaccggtccggt |
16508924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 159
Target Start/End: Original strand, 16524004 - 16524040
Alignment:
| Q |
123 |
aacgcaggggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
16524004 |
aacgaaggggattggaccggtcttggaccggtccggt |
16524040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 16)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 47 - 244
Target Start/End: Complemental strand, 17086155 - 17085958
Alignment:
| Q |
47 |
ggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtctt |
146 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17086155 |
ggatacggatctcacagagacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattagaccggtctt |
17086056 |
T |
 |
| Q |
147 |
gaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaaactcctctactctcgcctc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
17086055 |
gaaccggtccggtctagcgctctatataaaggcctaatgcgccggtttattcacttgcaccaaatctttctctctctaagctcctcttctctcgcctc |
17085958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 43 - 244
Target Start/End: Original strand, 34194598 - 34194799
Alignment:
| Q |
43 |
caaaggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccgg |
142 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
34194598 |
caaaggatccggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaagggctcacaacgcagggggttggaccgg |
34194697 |
T |
 |
| Q |
143 |
tcttgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaaactcctctactctcgcc |
242 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| || | |||||||||||||||||||||| |||||||| |
|
|
| T |
34194698 |
tcttgaaccggtccggtctagcgccctatataaaagcctaatgcgccggttttttcatttgcaacacacctttctctctctaaactcctcttctctcgcc |
34194797 |
T |
 |
| Q |
243 |
tc |
244 |
Q |
| |
|
|| |
|
|
| T |
34194798 |
tc |
34194799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 46 - 225
Target Start/End: Complemental strand, 21964410 - 21964231
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21964410 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
21964311 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
21964310 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
21964231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 46 - 225
Target Start/End: Complemental strand, 21979653 - 21979474
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21979653 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
21979554 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
21979553 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
21979474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 71 - 121
Target Start/End: Original strand, 6558172 - 6558222
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||||| ||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
6558172 |
cagggagcgttggattgatccaggaagccaaaccctagatctaaaggctca |
6558222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 159
Target Start/End: Original strand, 15082515 - 15082627
Alignment:
| Q |
47 |
ggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtctt |
146 |
Q |
| |
|
|||| |||||| ||| || | |||||||||||||||||| |||||| || | ||| ||||||||||||||| || | | |||| |||||||| | || |
|
|
| T |
15082515 |
ggatccggatcacacgggaaagctcagggatcgttggatcgatccaggaagcaaaaacctagatctaaaggcgcagatcaaagggaattggaccagaatt |
15082614 |
T |
 |
| Q |
147 |
gaaccggtccggt |
159 |
Q |
| |
|
||||||||||||| |
|
|
| T |
15082615 |
gaaccggtccggt |
15082627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 78 - 121
Target Start/End: Complemental strand, 1895036 - 1894993
Alignment:
| Q |
78 |
cgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
1895036 |
cgttggattgatccaggaagccaaaccctagatctaaaggctca |
1894993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 78 - 121
Target Start/End: Complemental strand, 1909837 - 1909794
Alignment:
| Q |
78 |
cgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
1909837 |
cgttggattgatccaggaagccaaaccctagatctaaaggctca |
1909794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 172
Target Start/End: Complemental strand, 1642210 - 1642168
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtctagcgctctata |
172 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| | |||||| |
|
|
| T |
1642210 |
gggattggaccggtcttgaaccgatccggtctaggggtctata |
1642168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 72 - 121
Target Start/End: Complemental strand, 12784869 - 12784820
Alignment:
| Q |
72 |
agggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
||||| ||||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
12784869 |
agggagcgttggattgatccaggaagcctaaccctagatctaaaggctca |
12784820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 78 - 119
Target Start/End: Original strand, 15652308 - 15652349
Alignment:
| Q |
78 |
cgttggattgatccaagatcccaaaccctagatctaaaggct |
119 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
15652308 |
cgttggattgatccaggaagccaaaccctagatctaaaggct |
15652349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 26139961 - 26139990
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26139961 |
gggattggaccggtcttgaaccggtccggt |
26139990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 33676286 - 33676257
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33676286 |
gggattggaccggtcttgaaccggtccggt |
33676257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 34271004 - 34270975
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34271004 |
gggattggaccggtcttgaaccggtccggt |
34270975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 35057920 - 35057949
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35057920 |
gggattggaccggtcttgaaccggtccggt |
35057949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 159
Target Start/End: Original strand, 19640544 - 19640580
Alignment:
| Q |
123 |
aacgcaggggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
19640544 |
aacgaaggggattggaccggtcttggaccggtccggt |
19640580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 47 - 244
Target Start/End: Original strand, 18684 - 18881
Alignment:
| Q |
47 |
ggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtctt |
146 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
18684 |
ggatacggatctcacagagacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattagaccggtctt |
18783 |
T |
 |
| Q |
147 |
gaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaaactcctctactctcgcctc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||||||| ||||||| |||||||||| |
|
|
| T |
18784 |
gaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcacttacaccaaatctttatctctctaagctcctcttctctcgcctc |
18881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 37)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 55 - 244
Target Start/End: Complemental strand, 22898086 - 22897897
Alignment:
| Q |
55 |
atctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtcttgaaccggt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
22898086 |
atctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtcttgaactggt |
22897987 |
T |
 |
| Q |
155 |
ccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaaactcctctactctcgcctc |
244 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
22897986 |
ccgttctagcgctctatataaaagcctaatgcgccggtttattcacttgcaccaaatctttctctctctaagctcctcttttctcgcctc |
22897897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 43 - 244
Target Start/End: Complemental strand, 26773001 - 26772800
Alignment:
| Q |
43 |
caaaggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccgg |
142 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
26773001 |
caaaggatccggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaagggctcacaacgcagggggttggaccgg |
26772902 |
T |
 |
| Q |
143 |
tcttgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaaactcctctactctcgcc |
242 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| || | |||||||||||||||||||||| |||||||| |
|
|
| T |
26772901 |
tcttgaaccggtccggtctagcgccctatataaaagcctaatgcgccggttttttcatttgcaacacacctttctctctctaaactcctcttctctcgcc |
26772802 |
T |
 |
| Q |
243 |
tc |
244 |
Q |
| |
|
|| |
|
|
| T |
26772801 |
tc |
26772800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 43 - 244
Target Start/End: Complemental strand, 27283238 - 27283037
Alignment:
| Q |
43 |
caaaggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccgg |
142 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
27283238 |
caaaggatccggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaagggctcacaacgcagggggttggaccgg |
27283139 |
T |
 |
| Q |
143 |
tcttgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaaactcctctactctcgcc |
242 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| || | |||||||||||||||||||||| |||||||| |
|
|
| T |
27283138 |
tcttgaaccggtccggtctagcgccctatataaaagcctaatgcgccggttttttcatttgcaacacacctttctctctctaaactcctcttctctcgcc |
27283039 |
T |
 |
| Q |
243 |
tc |
244 |
Q |
| |
|
|| |
|
|
| T |
27283038 |
tc |
27283037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 46 - 225
Target Start/End: Complemental strand, 33511068 - 33510889
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33511068 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
33510969 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
33510968 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
33510889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 46 - 225
Target Start/End: Complemental strand, 33526331 - 33526152
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33526331 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
33526232 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
33526231 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
33526152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 47 - 202
Target Start/End: Complemental strand, 30144428 - 30144274
Alignment:
| Q |
47 |
ggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtctt |
146 |
Q |
| |
|
|||| ||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
30144428 |
ggatccggatctcacaggaatgctcagggatcgttggattgatccaagatcccaaaccctagatctaagggctcacaacgcatgggattggaccggtctt |
30144329 |
T |
 |
| Q |
147 |
gaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcattt |
202 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| |||| |||||||||| ||||||| |
|
|
| T |
30144328 |
gaaccggtccggtctagcactctatat-aaaccctagcgcgccggttttttcattt |
30144274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 47 - 202
Target Start/End: Complemental strand, 30178478 - 30178324
Alignment:
| Q |
47 |
ggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtctt |
146 |
Q |
| |
|
|||| ||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
30178478 |
ggatccggatctcacaggaatgctcagggatcgttggattgatccaagatcccaaaccctagatctaagggctcacaacgcatgggattggaccggtctt |
30178379 |
T |
 |
| Q |
147 |
gaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcattt |
202 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| |||| |||||||||| ||||||| |
|
|
| T |
30178378 |
gaaccggtccggtctagcactctatat-aaaccctagcgcgccggttttttcattt |
30178324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 130 - 176
Target Start/End: Original strand, 28899243 - 28899289
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtctagcgctctatataaa |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
28899243 |
gggattggaccggtcttgaaccggtccggtctagtggtctatataaa |
28899289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 130 - 176
Target Start/End: Original strand, 28935638 - 28935684
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtctagcgctctatataaa |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
28935638 |
gggattggaccggtcttgaaccggtccggtctagtggtctatataaa |
28935684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 71 - 121
Target Start/End: Original strand, 34494476 - 34494526
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34494476 |
cagggagcgttggattgatccaagaaaccaaaccctagatctaaaggctca |
34494526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 130 - 175
Target Start/End: Original strand, 23723641 - 23723686
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtctagcgctctatataa |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
23723641 |
gggattggaccggtcttgaaccggtccggtctaggggtctatataa |
23723686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 18 - 56
Target Start/End: Original strand, 18118871 - 18118909
Alignment:
| Q |
18 |
taggcccaaacccaaagcccacactcaaaggatacggat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18118871 |
taggcccaaacccaaagcccacactcaaaagatacggat |
18118909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 18 - 56
Target Start/End: Original strand, 18129251 - 18129289
Alignment:
| Q |
18 |
taggcccaaacccaaagcccacactcaaaggatacggat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18129251 |
taggcccaaacccaaagcccacactcaaaagatacggat |
18129289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 130 - 172
Target Start/End: Complemental strand, 30956060 - 30956018
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtctagcgctctata |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
30956060 |
gggattggaccggtcttgaaccggtccggtctaggggtctata |
30956018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 82 - 159
Target Start/End: Complemental strand, 11544962 - 11544885
Alignment:
| Q |
82 |
ggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
||||||||||| || ||||||||||||| || ||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11544962 |
ggattgatccaggagatcaaaccctagatccaacggccaggaacgaaggggattggaccggtcttgaaccggtccggt |
11544885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 82 - 159
Target Start/End: Complemental strand, 11559021 - 11558944
Alignment:
| Q |
82 |
ggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
||||||||||| || ||||||||||||| || ||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11559021 |
ggattgatccaggagatcaaaccctagatccaacggccaggaacgaaggggattggaccggtcttgaaccggtccggt |
11558944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 130 - 163
Target Start/End: Complemental strand, 30929176 - 30929143
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtctag |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30929176 |
gggattggaccggtcttgaaccggtccggtctag |
30929143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 117
Target Start/End: Original strand, 22269842 - 22269888
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaagg |
117 |
Q |
| |
|
|||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
22269842 |
cagggagcgttggattgatccaggaagccaaaccctagatctaaagg |
22269888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 9312085 - 9312056
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9312085 |
gggattggaccggtcttgaaccggtccggt |
9312056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 9327344 - 9327315
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9327344 |
gggattggaccggtcttgaaccggtccggt |
9327315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 12126787 - 12126758
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12126787 |
gggattggaccggtcttgaaccggtccggt |
12126758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 12142040 - 12142011
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12142040 |
gggattggaccggtcttgaaccggtccggt |
12142011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 13315043 - 13315072
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13315043 |
gggattggaccggtcttgaaccggtccggt |
13315072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 13330370 - 13330399
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13330370 |
gggattggaccggtcttgaaccggtccggt |
13330399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 22444745 - 22444716
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22444745 |
gggattggaccggtcttgaaccggtccggt |
22444716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 24946657 - 24946628
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24946657 |
gggattggaccggtcttgaaccggtccggt |
24946628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 26475025 - 26474996
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26475025 |
gggattggaccggtcttgaaccggtccggt |
26474996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 26490073 - 26490044
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26490073 |
gggattggaccggtcttgaaccggtccggt |
26490044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 31426036 - 31426007
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31426036 |
gggattggaccggtcttgaaccggtccggt |
31426007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 31441374 - 31441345
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31441374 |
gggattggaccggtcttgaaccggtccggt |
31441345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 37661753 - 37661782
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37661753 |
gggattggaccggtcttgaaccggtccggt |
37661782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 37677036 - 37677065
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37677036 |
gggattggaccggtcttgaaccggtccggt |
37677065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 37742388 - 37742417
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37742388 |
gggattggaccggtcttgaaccggtccggt |
37742417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 37776470 - 37776499
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37776470 |
gggattggaccggtcttgaaccggtccggt |
37776499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 41300658 - 41300629
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41300658 |
gggattggaccggtcttgaaccggtccggt |
41300629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 46
Target Start/End: Original strand, 40463942 - 40463970
Alignment:
| Q |
18 |
taggcccaaacccaaagcccacactcaaa |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40463942 |
taggcccaaacccaaagcccacactcaaa |
40463970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 46
Target Start/End: Original strand, 40478833 - 40478861
Alignment:
| Q |
18 |
taggcccaaacccaaagcccacactcaaa |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40478833 |
taggcccaaacccaaagcccacactcaaa |
40478861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0252 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: scaffold0252
Description:
Target: scaffold0252; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 43 - 203
Target Start/End: Original strand, 1085 - 1245
Alignment:
| Q |
43 |
caaaggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccgg |
142 |
Q |
| |
|
||||||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1085 |
caaaggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcaggggattggaccgg |
1184 |
T |
 |
| Q |
143 |
tcttgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttg |
203 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |||||||||||| ||||||| |
|
|
| T |
1185 |
tcttgaaccggtccggtctagcgccctatataaaaccctagtgcgccggtttactcatttg |
1245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 46 - 225
Target Start/End: Original strand, 129917 - 130096
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
129917 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
130016 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
130017 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
130096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 28)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 46 - 225
Target Start/End: Complemental strand, 7987272 - 7987093
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7987272 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
7987173 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
7987172 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
7987093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 46 - 225
Target Start/End: Original strand, 30563526 - 30563705
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30563526 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
30563625 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
30563626 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
30563705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 46 - 225
Target Start/End: Complemental strand, 27192365 - 27192186
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27192365 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcctaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
27192266 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
27192265 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
27192186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 46 - 225
Target Start/End: Complemental strand, 27204218 - 27204039
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27204218 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcctaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
27204119 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
27204118 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
27204039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 46 - 225
Target Start/End: Original strand, 27245013 - 27245192
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27245013 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcctaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
27245112 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
27245113 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
27245192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 46 - 225
Target Start/End: Original strand, 27256876 - 27257055
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27256876 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcctaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
27256975 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
27256976 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
27257055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 46 - 194
Target Start/End: Original strand, 30548255 - 30548403
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30548255 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
30548354 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggttt |
194 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |
|
|
| T |
30548355 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttt |
30548403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 47 - 202
Target Start/End: Complemental strand, 27002382 - 27002228
Alignment:
| Q |
47 |
ggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtctt |
146 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
27002382 |
ggatccggatctcacaggaacgctcagggatcgttggattgatccaagatcccaaaccctagatctaagggctcacaacgcatgggattggaccggtctt |
27002283 |
T |
 |
| Q |
147 |
gaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcattt |
202 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| |||| |||||||||| ||||||| |
|
|
| T |
27002282 |
gaaccggtccggtctagcactctatat-aaaccctagcgcgccggttttttcattt |
27002228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 47 - 202
Target Start/End: Complemental strand, 27017888 - 27017734
Alignment:
| Q |
47 |
ggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtctt |
146 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
27017888 |
ggatccggatctcacaggaacgctcagggatcgttggattgatccaagatcccaaaccctagatctaagggctcacaacgcatgggattggaccggtctt |
27017789 |
T |
 |
| Q |
147 |
gaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcattt |
202 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| |||| |||||||||| ||||||| |
|
|
| T |
27017788 |
gaaccggtccggtctagcactctatat-aaaccctagcgcgccggttttttcattt |
27017734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 78 - 123
Target Start/End: Complemental strand, 20133630 - 20133585
Alignment:
| Q |
78 |
cgttggattgatccaagatcccaaaccctagatctaaaggctcaca |
123 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20133630 |
cgttggattgatccaagatcaaaaaccctagatctaaaggctcaca |
20133585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 78 - 123
Target Start/End: Original strand, 22199239 - 22199284
Alignment:
| Q |
78 |
cgttggattgatccaagatcccaaaccctagatctaaaggctcaca |
123 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22199239 |
cgttggattgatccaagatcaaaaaccctagatctaaaggctcaca |
22199284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 130 - 172
Target Start/End: Original strand, 22940514 - 22940556
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtctagcgctctata |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
22940514 |
gggattggaccggtcttgaaccggtccggtctagtggtctata |
22940556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 130 - 172
Target Start/End: Original strand, 23862958 - 23863000
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtctagcgctctata |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
23862958 |
gggattggaccggtcttgaaccggtccggtctagtggtctata |
23863000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 130 - 163
Target Start/End: Original strand, 30721773 - 30721806
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtctag |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30721773 |
gggattggaccggtcttgaaccggtccggtctag |
30721806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 123 - 159
Target Start/End: Complemental strand, 18939671 - 18939635
Alignment:
| Q |
123 |
aacgcaggggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18939671 |
aacgaaggggattggaccggtcttgaaccggtccggt |
18939635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 172
Target Start/End: Original strand, 22924802 - 22924844
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtctagcgctctata |
172 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| | |||||| |
|
|
| T |
22924802 |
gggattgggccggtcttgaaccggtccggtctaggggtctata |
22924844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 121
Target Start/End: Complemental strand, 25178812 - 25178762
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||||| |||| |||||||||| || |||||||||||||||||||||||| |
|
|
| T |
25178812 |
cagggagcgtttgattgatccaggaagccaaaccctagatctaaaggctca |
25178762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 175
Target Start/End: Original strand, 28198037 - 28198079
Alignment:
| Q |
133 |
attggaccggtcttgaaccggtccggtctagcgctctatataa |
175 |
Q |
| |
|
||||||||||| ||||||||||||||||||| | ||||||||| |
|
|
| T |
28198037 |
attggaccggtattgaaccggtccggtctaggggtctatataa |
28198079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 4729574 - 4729603
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4729574 |
gggattggaccggtcttgaaccggtccggt |
4729603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 16997562 - 16997533
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16997562 |
gggattggaccggtcttgaaccggtccggt |
16997533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 27212673 - 27212644
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27212673 |
gggattggaccggtcttgaaccggtccggt |
27212644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 27236555 - 27236584
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27236555 |
gggattggaccggtcttgaaccggtccggt |
27236584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 27307883 - 27307912
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27307883 |
gggattggaccggtcttgaaccggtccggt |
27307912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 32782083 - 32782112
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32782083 |
gggattggaccggtcttgaaccggtccggt |
32782112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 159
Target Start/End: Complemental strand, 12616596 - 12616560
Alignment:
| Q |
123 |
aacgcaggggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
12616596 |
aacgaaggggattggaccggtcttggaccggtccggt |
12616560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 159
Target Start/End: Original strand, 16346175 - 16346211
Alignment:
| Q |
123 |
aacgcaggggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
16346175 |
aacgaaggggattggaccggtcttggaccggtccggt |
16346211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 46
Target Start/End: Complemental strand, 27039099 - 27039071
Alignment:
| Q |
18 |
taggcccaaacccaaagcccacactcaaa |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27039099 |
taggcccaaacccaaagcccacactcaaa |
27039071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 46
Target Start/End: Complemental strand, 27067438 - 27067410
Alignment:
| Q |
18 |
taggcccaaacccaaagcccacactcaaa |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27067438 |
taggcccaaacccaaagcccacactcaaa |
27067410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 25)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 46 - 225
Target Start/End: Original strand, 17975003 - 17975182
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17975003 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
17975102 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
17975103 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
17975182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 46 - 225
Target Start/End: Original strand, 17990551 - 17990730
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17990551 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
17990650 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
17990651 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
17990730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 46 - 225
Target Start/End: Complemental strand, 18219844 - 18219665
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18219844 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
18219745 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
18219744 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
18219665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 46 - 225
Target Start/End: Complemental strand, 18235152 - 18234973
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18235152 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
18235053 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
18235052 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
18234973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 47 - 202
Target Start/End: Complemental strand, 28333934 - 28333780
Alignment:
| Q |
47 |
ggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtctt |
146 |
Q |
| |
|
|||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
28333934 |
ggatccggatttcacaggaacgctcagggatcgttggattgatccaagatcccaaaccctagatctaagggctcacaacgcatgggattggaccggtctt |
28333835 |
T |
 |
| Q |
147 |
gaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcattt |
202 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| |||| |||||||||| ||||||| |
|
|
| T |
28333834 |
gaaccggtccggtctagcactctatat-aaaccctagcgcgccggttttttcattt |
28333780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 47 - 202
Target Start/End: Complemental strand, 28349036 - 28348882
Alignment:
| Q |
47 |
ggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtctt |
146 |
Q |
| |
|
|||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
28349036 |
ggatccggatttcacaggaacgctcagggatcgttggattgatccaagatcccaaaccctagatctaagggctcacaacgcatgggattggaccggtctt |
28348937 |
T |
 |
| Q |
147 |
gaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcattt |
202 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| |||| |||||||||| ||||||| |
|
|
| T |
28348936 |
gaaccggtccggtctagcactctatat-aaaccctagcgcgccggttttttcattt |
28348882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 126 - 175
Target Start/End: Original strand, 28166920 - 28166969
Alignment:
| Q |
126 |
gcaggggattggaccggtcttgaaccggtccggtctagcgctctatataa |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
28166920 |
gcaggggattggaccggtcttgaaccggtccggtctagtggtctatataa |
28166969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 71 - 121
Target Start/End: Original strand, 14142558 - 14142608
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||||| ||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
14142558 |
cagggagcgttggattgatccaggaagccaaaccctagatctaaaggctca |
14142608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 71 - 121
Target Start/End: Complemental strand, 18525098 - 18525048
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||||| ||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
18525098 |
cagggagcgttggattgatccaggaagccaaaccctagatctaaaggctca |
18525048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 130 - 163
Target Start/End: Complemental strand, 4653314 - 4653281
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtctag |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4653314 |
gggattggaccggtcttgaaccggtccggtctag |
4653281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 72 - 121
Target Start/End: Original strand, 23012594 - 23012643
Alignment:
| Q |
72 |
agggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
||||| ||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
23012594 |
agggagcgttggattgatccaggaagccaaaccctagatctaaaggctca |
23012643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 119
Target Start/End: Complemental strand, 19448559 - 19448511
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaaggct |
119 |
Q |
| |
|
|||||| ||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
19448559 |
cagggagcgttggattgatccaggaagccaaaccctagatctaaaggct |
19448511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 80 - 114
Target Start/End: Original strand, 15365064 - 15365098
Alignment:
| Q |
80 |
ttggattgatccaagatcccaaaccctagatctaa |
114 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15365064 |
ttggattgatccaagatgccaaaccctagatctaa |
15365098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 1733997 - 1734026
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1733997 |
gggattggaccggtcttgaaccggtccggt |
1734026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 15883279 - 15883308
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15883279 |
gggattggaccggtcttgaaccggtccggt |
15883308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 15898458 - 15898487
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15898458 |
gggattggaccggtcttgaaccggtccggt |
15898487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 17904065 - 17904036
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17904065 |
gggattggaccggtcttgaaccggtccggt |
17904036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 17966888 - 17966917
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17966888 |
gggattggaccggtcttgaaccggtccggt |
17966917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 17997368 - 17997397
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17997368 |
gggattggaccggtcttgaaccggtccggt |
17997397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 19703925 - 19703896
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19703925 |
gggattggaccggtcttgaaccggtccggt |
19703896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 26685098 - 26685069
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26685098 |
gggattggaccggtcttgaaccggtccggt |
26685069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 47196840 - 47196869
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47196840 |
gggattggaccggtcttgaaccggtccggt |
47196869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 52 - 92
Target Start/End: Complemental strand, 17786905 - 17786865
Alignment:
| Q |
52 |
cggatctcacagggacgctcagggatcgttggattgatcca |
92 |
Q |
| |
|
|||||| |||||| | ||||||||||||||||||||||||| |
|
|
| T |
17786905 |
cggatcacacaggaaagctcagggatcgttggattgatcca |
17786865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 52 - 92
Target Start/End: Complemental strand, 19088426 - 19088386
Alignment:
| Q |
52 |
cggatctcacagggacgctcagggatcgttggattgatcca |
92 |
Q |
| |
|
|||||| |||||| | ||||||||||||||||||||||||| |
|
|
| T |
19088426 |
cggatcacacaggaaagctcagggatcgttggattgatcca |
19088386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 52 - 92
Target Start/End: Original strand, 19364876 - 19364916
Alignment:
| Q |
52 |
cggatctcacagggacgctcagggatcgttggattgatcca |
92 |
Q |
| |
|
|||||| |||||| | ||||||||||||||||||||||||| |
|
|
| T |
19364876 |
cggatcacacaggaaagctcagggatcgttggattgatcca |
19364916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 17)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 46 - 225
Target Start/End: Original strand, 16819643 - 16819822
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16819643 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
16819742 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
16819743 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
16819822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 46 - 225
Target Start/End: Original strand, 16834884 - 16835063
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16834884 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
16834983 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
16834984 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
16835063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 46 - 225
Target Start/End: Original strand, 16874865 - 16875044
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16874865 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
16874964 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
16874965 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
16875044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 46 - 225
Target Start/End: Complemental strand, 32059692 - 32059513
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
32059692 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcactacgcaggggattggaccggtct |
32059593 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
32059592 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
32059513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 46 - 225
Target Start/End: Complemental strand, 32044496 - 32044317
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| ||||||||| |||||| |||||||| ||||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
32044496 |
aggaaacggatctcccagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcactacgcaggggattggaccggtct |
32044397 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
32044396 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
32044317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 52 - 202
Target Start/End: Complemental strand, 35763580 - 35763431
Alignment:
| Q |
52 |
cggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtcttgaacc |
151 |
Q |
| |
|
||||| ||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35763580 |
cggatttcacaggaatgctcagggatcgttggattgatccaagatcccaaaccctagatctaatggctcacaacgcatgggattggaccggtcttgaacc |
35763481 |
T |
 |
| Q |
152 |
ggtccggtctagcgctctatataaaagcctaatgcgccggtttattcattt |
202 |
Q |
| |
|
||||||||||||| |||||||| ||| |||| |||||||||| ||||||| |
|
|
| T |
35763480 |
ggtccggtctagcactctatat-aaaccctagcgcgccggttttttcattt |
35763431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 130 - 176
Target Start/End: Original strand, 10116403 - 10116449
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtctagcgctctatataaa |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
10116403 |
gggattggaccggtcttgaaccggtccggtctagtggtctatataaa |
10116449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 71 - 121
Target Start/End: Original strand, 21693878 - 21693928
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||||| ||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
21693878 |
cagggagcgttggattgatccaggaagccaaaccctagatctaaaggctca |
21693928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 71 - 121
Target Start/End: Original strand, 21708659 - 21708709
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||||| ||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
21708659 |
cagggagcgttggattgatccaggaagccaaaccctagatctaaaggctca |
21708709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 78 - 111
Target Start/End: Complemental strand, 39884707 - 39884674
Alignment:
| Q |
78 |
cgttggattgatccaagatcccaaaccctagatc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39884707 |
cgttggattgatccaagatcccaaaccctagatc |
39884674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 78 - 111
Target Start/End: Complemental strand, 39900283 - 39900250
Alignment:
| Q |
78 |
cgttggattgatccaagatcccaaaccctagatc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39900283 |
cgttggattgatccaagatcccaaaccctagatc |
39900250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 2731177 - 2731148
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2731177 |
gggattggaccggtcttgaaccggtccggt |
2731148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 13819449 - 13819478
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13819449 |
gggattggaccggtcttgaaccggtccggt |
13819478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 64 - 121
Target Start/End: Original strand, 29439332 - 29439389
Alignment:
| Q |
64 |
ggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
||||||||||| |||| |||||||||| || |||||||||||||||||||||||| |
|
|
| T |
29439332 |
ggacgctcaggagccgttagattgatccaggaagccaaaccctagatctaaaggctca |
29439389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 40195038 - 40195067
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40195038 |
gggattggaccggtcttgaaccggtccggt |
40195067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 159
Target Start/End: Complemental strand, 28876742 - 28876706
Alignment:
| Q |
123 |
aacgcaggggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
28876742 |
aacgaaggggattggaccggtcttggaccggtccggt |
28876706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 159
Target Start/End: Complemental strand, 28891952 - 28891916
Alignment:
| Q |
123 |
aacgcaggggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
28891952 |
aacgaaggggattggaccggtcttggaccggtccggt |
28891916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 11)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 46 - 225
Target Start/End: Original strand, 4486592 - 4486771
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
4486592 |
aggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcagggaattggaccggtct |
4486691 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
4486692 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
4486771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 130 - 172
Target Start/End: Complemental strand, 17896873 - 17896831
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtctagcgctctata |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
17896873 |
gggattggaccggtcttgaaccggtccggtctaggggtctata |
17896831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 554657 - 554628
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
554657 |
gggattggaccggtcttgaaccggtccggt |
554628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 6053467 - 6053496
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6053467 |
gggattggaccggtcttgaaccggtccggt |
6053496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 14026245 - 14026274
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14026245 |
gggattggaccggtcttgaaccggtccggt |
14026274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 19669202 - 19669173
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19669202 |
gggattggaccggtcttgaaccggtccggt |
19669173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 78 - 111
Target Start/End: Complemental strand, 19697697 - 19697664
Alignment:
| Q |
78 |
cgttggattgatccaagatcccaaaccctagatc |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
19697697 |
cgttagattgatccaagatcccaaaccctagatc |
19697664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 21338264 - 21338293
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21338264 |
gggattggaccggtcttgaaccggtccggt |
21338293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 21378225 - 21378254
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21378225 |
gggattggaccggtcttgaaccggtccggt |
21378254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 24462254 - 24462283
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24462254 |
gggattggaccggtcttgaaccggtccggt |
24462283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 44570839 - 44570810
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44570839 |
gggattggaccggtcttgaaccggtccggt |
44570810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1536 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: scaffold1536
Description:
Target: scaffold1536; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 46 - 225
Target Start/End: Complemental strand, 1196 - 1017
Alignment:
| Q |
46 |
aggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtct |
145 |
Q |
| |
|
|||| |||||||||||||||| | |||||| ||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1196 |
aggaaacggatctcacagggatacacagggaccgttggattgatccaaggtcctaaaccctagatctaagggctcacaacgcaggggattggaccggtct |
1097 |
T |
 |
| Q |
146 |
tgaaccggtccggtctagcgctctatataaaagcctaatgcgccggtttattcatttgcaccaaatctttctctctctaa |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
1096 |
tgaaccggtccggtctagcgccctatataaaaccctaacgcgccggttttttcatttgtcacacacctttctctctctaa |
1017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 14)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 43 - 145
Target Start/End: Complemental strand, 47767224 - 47767122
Alignment:
| Q |
43 |
caaaggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccgg |
142 |
Q |
| |
|
||||||| |||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
47767224 |
caaaggaaacggatctcacagggatactcagggaccgttggattgatccaaggtcccaaaccctagatctaagggctcacaacgcaagggattggaccgg |
47767125 |
T |
 |
| Q |
143 |
tct |
145 |
Q |
| |
|
||| |
|
|
| T |
47767124 |
tct |
47767122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 130 - 176
Target Start/End: Original strand, 16653689 - 16653735
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtctagcgctctatataaa |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
16653689 |
gggattggaccggtcttgaaccggtccggtctagtggtctatataaa |
16653735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 117
Target Start/End: Complemental strand, 16404846 - 16404800
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaagg |
117 |
Q |
| |
|
|||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
16404846 |
cagggagcgttggattgatccaggaagccaaaccctagatctaaagg |
16404800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 121
Target Start/End: Original strand, 20344332 - 20344382
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||||| |||| |||||||||| || |||||||||||||||||||||||| |
|
|
| T |
20344332 |
cagggagcgttagattgatccaggaaaccaaaccctagatctaaaggctca |
20344382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 160
Target Start/End: Original strand, 36088884 - 36088914
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtc |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36088884 |
gggattggaccggtcttgaaccggtccggtc |
36088914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 10938098 - 10938069
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10938098 |
gggattggaccggtcttgaaccggtccggt |
10938069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 10957289 - 10957260
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10957289 |
gggattggaccggtcttgaaccggtccggt |
10957260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 10972512 - 10972483
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10972512 |
gggattggaccggtcttgaaccggtccggt |
10972483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 28579572 - 28579543
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28579572 |
gggattggaccggtcttgaaccggtccggt |
28579543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 28594998 - 28594969
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28594998 |
gggattggaccggtcttgaaccggtccggt |
28594969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 47353413 - 47353442
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47353413 |
gggattggaccggtcttgaaccggtccggt |
47353442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 159
Target Start/End: Complemental strand, 18292667 - 18292631
Alignment:
| Q |
123 |
aacgcaggggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
18292667 |
aacgaaggggattggaccggtcttggaccggtccggt |
18292631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 159
Target Start/End: Complemental strand, 20455825 - 20455765
Alignment:
| Q |
99 |
caaaccctagatctaaaggctcacaacgcaggggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
||||||||||||| || ||| | || | |||||||||||||||||||| ||||||||||| |
|
|
| T |
20455825 |
caaaccctagatccaacggccaagaatggaggggattggaccggtcttggaccggtccggt |
20455765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 159
Target Start/End: Complemental strand, 21480644 - 21480608
Alignment:
| Q |
123 |
aacgcaggggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
21480644 |
aacgaaggggattggaccggtcttggaccggtccggt |
21480608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 47 - 121
Target Start/End: Complemental strand, 179254 - 179180
Alignment:
| Q |
47 |
ggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
179254 |
ggatacggatctcacatggacgctcagagatcgttggattgatccaggaagccaaaccctagatctaaaggctca |
179180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 71 - 121
Target Start/End: Complemental strand, 98317 - 98267
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
98317 |
cagggatcgttggattgatccaggaagccaaaccctagatctaaaggctca |
98267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0750 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0750
Description:
Target: scaffold0750; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 71 - 121
Target Start/End: Original strand, 152 - 202
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||||| ||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
152 |
cagggagcgttggattgatccaggaagccaaaccctagatctaaaggctca |
202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 71 - 121
Target Start/End: Original strand, 17245 - 17295
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||||| ||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
17245 |
cagggagcgttggattgatccaggaagccaaaccctagatctaaaggctca |
17295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0225 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0225
Description:
Target: scaffold0225; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 130 - 163
Target Start/End: Original strand, 273 - 306
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtctag |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
273 |
gggattggaccggtcttgaaccggtccggtctag |
306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0393 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0393
Description:
Target: scaffold0393; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 159
Target Start/End: Complemental strand, 6212 - 6100
Alignment:
| Q |
47 |
ggatacggatctcacagggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaaaggctcacaacgcaggggattggaccggtctt |
146 |
Q |
| |
|
|||| |||||| ||| || | |||||||||||||||||| |||||| || | ||| ||||||||||||||| || | | |||| |||||||| | || |
|
|
| T |
6212 |
ggatccggatcacacgggaaagctcagggatcgttggatcgatccaggaagcaaaaacctagatctaaaggcgcagatcaaagggaattggaccagaatt |
6113 |
T |
 |
| Q |
147 |
gaaccggtccggt |
159 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6112 |
gaaccggtccggt |
6100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0184 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0184
Description:
Target: scaffold0184; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 73 - 121
Target Start/End: Complemental strand, 21929 - 21881
Alignment:
| Q |
73 |
gggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
21929 |
gggagcgttggattgatccaggaaaccaaaccctagatctaaaggctca |
21881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 73 - 121
Target Start/End: Original strand, 50915 - 50963
Alignment:
| Q |
73 |
gggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
50915 |
gggagcgttggattgatccaggaaaccaaaccctagatctaaaggctca |
50963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1665 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold1665
Description:
Target: scaffold1665; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 68 - 111
Target Start/End: Original strand, 838 - 881
Alignment:
| Q |
68 |
gctcagggatcgttggattgatccaagatcccaaaccctagatc |
111 |
Q |
| |
|
||||||| | |||||||||||||||||| ||||||||||||||| |
|
|
| T |
838 |
gctcaggaaccgttggattgatccaagaccccaaaccctagatc |
881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0740 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0740
Description:
Target: scaffold0740; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 117
Target Start/End: Complemental strand, 991 - 945
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaagg |
117 |
Q |
| |
|
|||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
991 |
cagggagcgttggattgatccaggaagccaaaccctagatctaaagg |
945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0260 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0260
Description:
Target: scaffold0260; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 121
Target Start/End: Original strand, 6655 - 6705
Alignment:
| Q |
71 |
cagggatcgttggattgatccaagatcccaaaccctagatctaaaggctca |
121 |
Q |
| |
|
|||||| |||| |||||||||| || |||||||||||||||||||||||| |
|
|
| T |
6655 |
cagggagcgttagattgatccaggaaaccaaaccctagatctaaaggctca |
6705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0235 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0235
Description:
Target: scaffold0235; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 114
Target Start/End: Original strand, 209 - 259
Alignment:
| Q |
64 |
ggacgctcagggatcgttggattgatccaagatcccaaaccctagatctaa |
114 |
Q |
| |
|
|||||| |||| | |||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
209 |
ggacgcacaggaaccgttggatagatccaagatgccaaaccctagatctaa |
259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0134 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0134
Description:
Target: scaffold0134; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 172
Target Start/End: Complemental strand, 22443 - 22401
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtctagcgctctata |
172 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| | |||||| |
|
|
| T |
22443 |
gggattggaccggtcttgaatcggtccggtctaggggtctata |
22401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 172
Target Start/End: Complemental strand, 37093 - 37051
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggtctagcgctctata |
172 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| | |||||| |
|
|
| T |
37093 |
gggattggaccggtcttgaaccggttcggtctaggggtctata |
37051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1648 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold1648
Description:
Target: scaffold1648; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 835 - 864
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
835 |
gggattggaccggtcttgaaccggtccggt |
864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Original strand, 32876 - 32905
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32876 |
gggattggaccggtcttgaaccggtccggt |
32905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0017
Description:
Target: scaffold0017; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 165915 - 165886
Alignment:
| Q |
130 |
gggattggaccggtcttgaaccggtccggt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
165915 |
gggattggaccggtcttgaaccggtccggt |
165886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University