View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5588_high_23 (Length: 222)
Name: NF5588_high_23
Description: NF5588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5588_high_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 3157990 - 3157776
Alignment:
| Q |
1 |
ttgatatttctactttctgtgatggctcgtgggttcaaattatattcaccaagataaattcaaacatctctttaatacattatttattgatttatgttca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3157990 |
ttgatatttctactttctgtgatggctcgtgggttcaaattatattcaccaagataaattcaaacatctctttaatatattatttattgatttatgttca |
3157891 |
T |
|
| Q |
101 |
tttattggccagtaatattacttgaattttgaaaataaaataaag-aattatatttgtataaaatttttggacaattttatctcttatatacggattgtg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3157890 |
tttattggccagtaatattacttgaattttgaaaataaaataaagaaattatatttgtataaaatttttggacaattttatctcttatacacggattgtg |
3157791 |
T |
|
| Q |
200 |
tttttatttcttctc |
214 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
3157790 |
tttttatttcatctc |
3157776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University