View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5588_low_9 (Length: 313)
Name: NF5588_low_9
Description: NF5588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5588_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 12 - 288
Target Start/End: Original strand, 43068674 - 43068950
Alignment:
| Q |
12 |
atgaatgtgaagggaatcaaagatggtaacagtaacaaaaattggattgttaagcaagatgtggatgatgatgatgtaactgattcaatttcgaatggat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43068674 |
atgaatgtgaagggaatcaaagatggtaacagtaacaaaaattggattgttaagcaagatgtggatgatgatgatgtaactgattcaatttcgaatggat |
43068773 |
T |
 |
| Q |
112 |
ctattacagaagattcaatgaattctatgtgttcatcttcttcatcagagttagatgatgatcaagaagtatcctcttcaacttctagtttgtcatcttc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43068774 |
ctattacagaagattcaatgaattctatgtgttcatcttcttcatcagagttagatgatgatcaagaagcatcctcttcaacttctagtttgtcatcttc |
43068873 |
T |
 |
| Q |
212 |
atcatcatcacattcaaatggtcccttatatgaactatcagaacttatgaaccatctccctttgaagtaagcaatat |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43068874 |
atcatcatcacattcaaatggtcccttatatgaactatcagaacttatgaaccatctccctttgaagtaagcaatat |
43068950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University