View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5589-Insertion-10 (Length: 76)
Name: NF5589-Insertion-10
Description: NF5589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5589-Insertion-10 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 62; Significance: 2e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 7 - 76
Target Start/End: Complemental strand, 42636103 - 42636034
Alignment:
| Q |
7 |
acctttatgattacttgcatagcattgtatcacatgcatcgccaatgcactgatttacttcaatttttcc |
76 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42636103 |
acctttatgattacttgcatagcatcgtatcacatgcatcaccaatgcactgatttacttcaatttttcc |
42636034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 62
Target Start/End: Complemental strand, 49601203 - 49601162
Alignment:
| Q |
21 |
ttgcatagcattgtatcacatgcatcgccaatgcactgattt |
62 |
Q |
| |
|
||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
49601203 |
ttgcatagcattgaatcacatacatcaccaatgcactgattt |
49601162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University