View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5589-Insertion-12 (Length: 109)
Name: NF5589-Insertion-12
Description: NF5589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5589-Insertion-12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 2e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 2e-34
Query Start/End: Original strand, 8 - 109
Target Start/End: Original strand, 48525922 - 48526023
Alignment:
| Q |
8 |
tataatattatatctaacaatatcgatattgtcaattgagttatgtcttacaaatattaataatttaatttctatacagtatgagtgtaaaatgttttaa |
107 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |||||||||||| |||| |
|
|
| T |
48525922 |
tataatattctatctaataatatcgatattgtcaattgagttatgtcttctaaatattaataatttaatttctattcagtataagtgtaaaatgtattaa |
48526021 |
T |
|
| Q |
108 |
tg |
109 |
Q |
| |
|
|| |
|
|
| T |
48526022 |
tg |
48526023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 19 - 50
Target Start/End: Complemental strand, 29688589 - 29688558
Alignment:
| Q |
19 |
atctaacaatatcgatattgtcaattgagtta |
50 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |
|
|
| T |
29688589 |
atctaacaatatcaatattgtcaattgagtta |
29688558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University