View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5589-Insertion-14 (Length: 125)
Name: NF5589-Insertion-14
Description: NF5589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5589-Insertion-14 |
 |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0015 (Bit Score: 88; Significance: 1e-42; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 16 - 125
Target Start/End: Complemental strand, 20451 - 20345
Alignment:
| Q |
16 |
cactatatctttctgaaactagattcatagccttcaattaatctcttcttgttggcgaaattatcacaaattaaggccattccctcatcaataaaaacac |
115 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20451 |
cactatatctttctaaaactagattcatagtcttcaattaatctctt---gttggcgaaattatcacaaattaaggccattccctcatcaataaaaacac |
20355 |
T |
 |
| Q |
116 |
gatgaacttg |
125 |
Q |
| |
|
|||||||||| |
|
|
| T |
20354 |
gatgaacttg |
20345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University