View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5589-Insertion-15 (Length: 59)
Name: NF5589-Insertion-15
Description: NF5589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5589-Insertion-15 |
 | |
|
| [»] chr5 (4 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 53; Significance: 3e-22; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 3e-22
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 12740473 - 12740525
Alignment:
| Q |
7 |
aaatggaacaactccacccttcaccacatttgcagaatgtttcactgccattg |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12740473 |
aaatggaacaactccacccttcaccacatttgcagaatgtttcactgccattg |
12740525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 3e-22
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 12803297 - 12803349
Alignment:
| Q |
7 |
aaatggaacaactccacccttcaccacatttgcagaatgtttcactgccattg |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12803297 |
aaatggaacaactccacccttcaccacatttgcagaatgtttcactgccattg |
12803349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 12732966 - 12733018
Alignment:
| Q |
7 |
aaatggaacaactccacccttcaccacatttgcagaatgtttcactgccattg |
59 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12732966 |
aaatggaacaactccatccttcaccacacttgcagaatgtttcactgccattg |
12733018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 12795768 - 12795820
Alignment:
| Q |
7 |
aaatggaacaactccacccttcaccacatttgcagaatgtttcactgccattg |
59 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12795768 |
aaatggaacaactccatccttcaccacacttgcagaatgtttcactgccattg |
12795820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University