View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5589_high_27 (Length: 320)
Name: NF5589_high_27
Description: NF5589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5589_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 121 - 305
Target Start/End: Original strand, 50345188 - 50345372
Alignment:
| Q |
121 |
cattctactgcgtctggtgttaaggcaacttgtgtatccctgaagatctcacacacaaaatttcaagtcagggtgggtgcccttaggtatatccccgcta |
220 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50345188 |
cattctactgcgtcaggtgttaaggcaacttgtgtatccctgaagatctcacacacaaaatttcaagtccgggtgggtgcccttaggtatatccccgcta |
50345287 |
T |
 |
| Q |
221 |
gtcagtaacctaactgttaaatatctagtagggacgcatcatgggatgatttatttttaagaaactacatgggataaagttagtt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50345288 |
gtcagtaacctaactgttaaatatctagtagggacgcatcatgggatgatttatttttaagaaactacatgggataaagttagtt |
50345372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 6 - 42
Target Start/End: Original strand, 50345073 - 50345109
Alignment:
| Q |
6 |
atgataacacaaatatattaaccaactaaataggttt |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50345073 |
atgataacacaaatatattaaccaactaaataggttt |
50345109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University