View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5589_high_32 (Length: 247)
Name: NF5589_high_32
Description: NF5589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5589_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 152 - 231
Target Start/End: Complemental strand, 1328325 - 1328246
Alignment:
| Q |
152 |
ctactagaagctgacaattctagcttcacaaattcacggtaaaatgacatgctaaacgtacatctaacactagaaaagct |
231 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1328325 |
ctactagaagctgaaaattctagcttcacaaattcacggtaaaatgacatgctaaacgtatgtctaacactagaaaagct |
1328246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 18 - 111
Target Start/End: Complemental strand, 1328420 - 1328326
Alignment:
| Q |
18 |
atatatctacagccttgcataatggaattgcagtgagg-tggnnnnnnntcatctacaagatagcagaatgtgagcagcagtaatttacacaaat |
111 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| || ||||||||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
1328420 |
atatatctacagccatgcataatggaattgcagtgaggttgaaaaaaaatcatctacaagatagaagaatgtgagcggcagtaattaacacaaat |
1328326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 54
Target Start/End: Complemental strand, 4878968 - 4878917
Alignment:
| Q |
4 |
aaacaagccaa-aacatatatctacagccttgcataatggaattgcagtgag |
54 |
Q |
| |
|
||||||||||| |||||||| |||||||| |||||||||||| ||||||||| |
|
|
| T |
4878968 |
aaacaagccaacaacatatacctacagccatgcataatggaactgcagtgag |
4878917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University