View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5589_high_46 (Length: 201)
Name: NF5589_high_46
Description: NF5589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5589_high_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 66 - 182
Target Start/End: Original strand, 5447953 - 5448069
Alignment:
| Q |
66 |
aaaagggaaaaatatgtagaagtattcacaatgcacctcacaatgatagtgacaataaacaaactaaactttgaaaagtttctgcaacataggagagtgg |
165 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5447953 |
aaaagagaaaaatatgtacaagtattcacaatgcacctcacaatgatagtgacaataaacaaactaaactttgaaaagtttctgcaacataggagagtgg |
5448052 |
T |
 |
| Q |
166 |
tgtatttgcatgccaat |
182 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5448053 |
tgtatttgcatgccaat |
5448069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University