View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5589_low_41 (Length: 228)
Name: NF5589_low_41
Description: NF5589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5589_low_41 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 228
Target Start/End: Original strand, 29286957 - 29287178
Alignment:
| Q |
7 |
atttggtacgcaaccatgtgggctatttggcaagcaagaaatcgaattatttttaagaacgacacgagggtggatgaggagatcgtggaggaggtggagg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29286957 |
atttggtacgcaaccatgtgggctatttggcaagcaagaaatcgaattatttttaagaatgacacgagggtggatgaggagatcgtggaggaggtggagg |
29287056 |
T |
|
| Q |
107 |
tgttataatgaagatggagtttacaaagattaaaaatcccgacatgtttgttttatgaatgaagttggaatccaagggactgcctattgtagtgattgtg |
206 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
29287057 |
tgttatcatgaagatggagtttacaaagattaaaaatcccgacatgtttgttttatgaatgaagttggaatccaagggactgcctattatagtgattgag |
29287156 |
T |
|
| Q |
207 |
gagagaagagggtggtaggttc |
228 |
Q |
| |
|
||||||||||||||| |||||| |
|
|
| T |
29287157 |
gagagaagagggtggaaggttc |
29287178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 191
Target Start/End: Complemental strand, 10727978 - 10727932
Alignment:
| Q |
145 |
ccgacatgtttgttttatgaatgaagttggaatccaagggactgcct |
191 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||| || ||||| |
|
|
| T |
10727978 |
ccgacatgtttgttttatgaatgatgttggaacccaagagattgcct |
10727932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University