View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5589_low_42 (Length: 227)
Name: NF5589_low_42
Description: NF5589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5589_low_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 41943303 - 41943496
Alignment:
| Q |
18 |
ttgagaacataaagcagtgggatctacataatttttatgagaataaatgtttagtattgctatggcataaagtttatgttgcataatgtaactcaagatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41943303 |
ttgagaacataaagcagtgggatctacataatttttatgagaataaatgtttagtattgctatggcataaagtttatgttgcataatgtaactcaagatt |
41943402 |
T |
|
| Q |
118 |
actaataagtttttggtagtattattacaaaacgatagaaagagagaaacatgacattaaaaacccagagaaatatgcattatacttccatttt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41943403 |
actaataagtttttggtagtattattacaaaacgatagaaagagagaaacatgacattaaaaacccagagaaatatgcattatgcttccatttt |
41943496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University