View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5589_low_44 (Length: 223)
Name: NF5589_low_44
Description: NF5589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5589_low_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 28007944 - 28007740
Alignment:
| Q |
1 |
tgagatggacatcatcacataaagctaccgtaagttacattttatatcttgaacaatatcaccatgctgtcatcgtgattttgccatattttatggttaa |
100 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| || |
|
|
| T |
28007944 |
tgagattgacaaaatcacataaagctaccgtaagttacattttatatcttgaacaatatcacgatgctgtcatcgtgattttgccatattc-atggtcaa |
28007846 |
T |
|
| Q |
101 |
ttttaacatttgttaagagttgcataacttggtcaacaattgtttgaccaacctagatttcaattttgattttacggatgtggaaccaaacataagctaa |
200 |
Q |
| |
|
|||||||||||||||||||||| || || |||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28007845 |
ttttaacatttgttaagagttgtatgacgtggtcaaccactgtttgaccaacctagatttcaattttgattttacggatgtggaaccaaacataggctaa |
28007746 |
T |
|
| Q |
201 |
aatgct |
206 |
Q |
| |
|
|||||| |
|
|
| T |
28007745 |
aatgct |
28007740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University