View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5590-Insertion-12 (Length: 170)
Name: NF5590-Insertion-12
Description: NF5590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5590-Insertion-12 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 8 - 170
Target Start/End: Complemental strand, 30809225 - 30809063
Alignment:
| Q |
8 |
atttttgccattcaggcagtttgttgtcgttccttcatgaatnnnnnnnnctttcgagaatatatatgaaaagttggaaactatgaaggtnnnnnnnngt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30809225 |
atttttgccattcaggcagtttgttgtcgttccttcatgaataaaaaaaactttagagaatatatatgaaaagttggaaactatgaaggtaaaaaaaagt |
30809126 |
T |
 |
| Q |
108 |
ctgttacccgagtttgggacacacagatccaaccatatacgtgtccatctagtcagaaccctc |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30809125 |
ctgttacccgagtttgggacacacagatccaaccatatacgtgtccatctagtcagaaccctc |
30809063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 157
Target Start/End: Complemental strand, 30820895 - 30820847
Alignment:
| Q |
109 |
tgttacccgagtttgggacacacagatccaaccatatacgtgtccatct |
157 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | || |||| ||||||| |
|
|
| T |
30820895 |
tgttacccgagtttgggacactcagatccaagcgtacacgtatccatct |
30820847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University