View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5590-Insertion-4 (Length: 267)
Name: NF5590-Insertion-4
Description: NF5590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5590-Insertion-4 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 69 - 267
Target Start/End: Original strand, 18484988 - 18485186
Alignment:
| Q |
69 |
tgaaggaacaaattcttgggaatccgtcgtatagaacccactcatggggtaatccatctccaaccaaccaatgaatgttatttattggaaagctcgaggg |
168 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| ||| ||||||| | |
|
|
| T |
18484988 |
tgaaggcacaaattcttgggaatccgccgtatagaacccactcatggggtgatccatctccaactgaccaatgaatgttatttattcgaacgctcgagag |
18485087 |
T |
|
| Q |
169 |
agatgagcccctcgctagcccagctcaatgaatcacaatctgaggtgcatacatgttcaccccacctgcactcacaagccaaaatttctgctgttacgg |
267 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18485088 |
agatgagcccctcgcttgcccagctcaatgaatcacaatctgaggtgcatacatgttcaccccacctgcactcacaagccaaaatttctgctgttacgg |
18485186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 165 - 263
Target Start/End: Original strand, 11212678 - 11212776
Alignment:
| Q |
165 |
agggagatgagcccctcgctagcccagctcaatgaatcacaatctgaggtgcatacatgttcaccccacctgcactcacaagccaaaatttctgctgtt |
263 |
Q |
| |
|
||||||||||| ||||||| | ||||| |||||||||| |||||||||||||||||| |||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11212678 |
agggagatgagtccctcgccaacccagatcaatgaatctcaatctgaggtgcatacaggttcgccccacctgcactcacaagccaaagtttctgctgtt |
11212776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 8 - 41
Target Start/End: Original strand, 18484920 - 18484953
Alignment:
| Q |
8 |
caacgcacagcagaggaaattttcactcaggtta |
41 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
18484920 |
caacgcacagcagaggaaattttcactccggtta |
18484953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 169 - 263
Target Start/End: Complemental strand, 34216059 - 34215965
Alignment:
| Q |
169 |
agatgagcccctcgctagcccagctcaatgaatcacaatctgaggtgcatacatgttcaccccacctgcactcacaagccaaaatttctgctgtt |
263 |
Q |
| |
|
||||||| |||||||| |||||| |||||||||| |||||| ||||||||||| |||| |||| |||||||||||||||||||||||||| |||| |
|
|
| T |
34216059 |
agatgagtccctcgctggcccagatcaatgaatcgcaatctaaggtgcatacaggttcgccccgcctgcactcacaagccaaaatttctgttgtt |
34215965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University