View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5590-Insertion-5 (Length: 1100)

Name: NF5590-Insertion-5
Description: NF5590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5590-Insertion-5
NF5590-Insertion-5
[»] chr3 (68 HSPs)
chr3 (8-1059)||(33235063-33236111)
chr3 (450-632)||(40272813-40272994)
chr3 (441-632)||(39203482-39203670)
chr3 (451-621)||(6411834-6412002)
chr3 (450-632)||(13628791-13628975)
chr3 (471-632)||(12914036-12914196)
chr3 (471-632)||(26869703-26869862)
chr3 (473-633)||(22609764-22609922)
chr3 (452-632)||(29366721-29366902)
chr3 (473-631)||(26573125-26573282)
chr3 (471-632)||(46421035-46421198)
chr3 (471-632)||(13730603-13730765)
chr3 (474-620)||(34420656-34420802)
chr3 (450-631)||(8247688-8247871)
chr3 (450-632)||(1217065-1217244)
chr3 (471-584)||(4495713-4495825)
chr3 (471-635)||(22122915-22123076)
chr3 (478-629)||(7942993-7943143)
chr3 (522-633)||(31904856-31904968)
chr3 (473-632)||(53996566-53996725)
chr3 (522-632)||(54484736-54484847)
chr3 (483-632)||(516417-516568)
chr3 (509-632)||(14986990-14987115)
chr3 (509-632)||(10795424-10795549)
chr3 (522-632)||(45786215-45786327)
chr3 (509-613)||(55401209-55401314)
chr3 (449-632)||(16735415-16735596)
chr3 (477-621)||(45948850-45948996)
chr3 (496-629)||(54374349-54374483)
chr3 (474-616)||(9607202-9607345)
chr3 (522-632)||(49013474-49013586)
chr3 (471-632)||(52926220-52926371)
chr3 (509-632)||(31592882-31593003)
chr3 (473-580)||(45620881-45620988)
chr3 (476-632)||(5173720-5173876)
chr3 (449-575)||(7696945-7697068)
chr3 (474-632)||(25944468-25944626)
chr3 (525-614)||(9276313-9276401)
chr3 (471-560)||(10870025-10870112)
chr3 (525-632)||(15797271-15797376)
chr3 (522-633)||(31672739-31672851)
chr3 (473-548)||(35417914-35417988)
chr3 (486-584)||(54032608-54032705)
chr3 (522-583)||(47624088-47624148)
chr3 (534-631)||(353351-353450)
chr3 (473-621)||(19731000-19731147)
chr3 (540-632)||(34771365-34771457)
chr3 (522-632)||(25517171-25517282)
chr3 (558-632)||(24578007-24578081)
chr3 (477-583)||(30928197-30928302)
chr3 (508-619)||(43114882-43114995)
chr3 (486-632)||(45139479-45139624)
chr3 (473-550)||(53062036-53062112)
chr3 (526-621)||(19751628-19751723)
chr3 (525-583)||(52428527-52428585)
chr3 (473-621)||(44403567-44403715)
chr3 (482-558)||(12525414-12525489)
chr3 (594-633)||(31922839-31922878)
chr3 (558-632)||(24577917-24577991)
chr3 (486-583)||(33926094-33926190)
chr3 (477-567)||(39211992-39212081)
chr3 (509-573)||(21875046-21875111)
chr3 (598-641)||(47624221-47624264)
chr3 (598-632)||(4495677-4495711)
chr3 (481-582)||(8410918-8411016)
chr3 (598-632)||(10484617-10484651)
chr3 (598-632)||(40390363-40390397)
chr3 (598-632)||(54032572-54032606)
[»] chr8 (53 HSPs)
chr8 (430-632)||(36720728-36720930)
chr8 (471-632)||(28817627-28817787)
chr8 (471-634)||(45071239-45071400)
chr8 (472-632)||(2626494-2626656)
chr8 (471-632)||(35261653-35261813)
chr8 (450-632)||(39460995-39461178)
chr8 (471-632)||(12670251-12670409)
chr8 (471-632)||(13160676-13160835)
chr8 (475-628)||(29521690-29521842)
chr8 (471-632)||(44530123-44530283)
chr8 (449-632)||(30454098-30454278)
chr8 (471-632)||(17823550-17823710)
chr8 (473-634)||(22598133-22598292)
chr8 (471-632)||(12625863-12626024)
chr8 (471-632)||(8897765-8897925)
chr8 (522-631)||(29877118-29877227)
chr8 (471-632)||(6760796-6760958)
chr8 (477-629)||(18164764-18164914)
chr8 (472-632)||(26954107-26954269)
chr8 (458-632)||(25250483-25250658)
chr8 (471-632)||(7136528-7136690)
chr8 (473-627)||(20284075-20284232)
chr8 (473-627)||(21070703-21070861)
chr8 (473-620)||(44781517-44781665)
chr8 (509-621)||(5689642-5689754)
chr8 (509-621)||(8483950-8484062)
chr8 (509-632)||(5135291-5135413)
chr8 (522-632)||(10857852-10857963)
chr8 (473-582)||(14018019-14018128)
chr8 (471-568)||(20869563-20869657)
chr8 (522-641)||(20869947-20870068)
chr8 (479-632)||(31457155-31457306)
chr8 (474-613)||(24365079-24365218)
chr8 (524-632)||(16225045-16225155)
chr8 (471-632)||(28407390-28407537)
chr8 (471-565)||(11748273-11748366)
chr8 (533-630)||(44742521-44742619)
chr8 (497-621)||(389642-389768)
chr8 (476-559)||(30962847-30962929)
chr8 (476-582)||(35105902-35106008)
chr8 (525-620)||(17250888-17250985)
chr8 (524-584)||(23286374-23286432)
chr8 (532-621)||(40604918-40605006)
chr8 (522-583)||(43942348-43942411)
chr8 (473-583)||(11000999-11001109)
chr8 (931-974)||(40576991-40577034)
chr8 (473-583)||(42083748-42083858)
chr8 (559-632)||(26102578-26102651)
chr8 (555-632)||(16013511-16013590)
chr8 (540-620)||(19729382-19729462)
chr8 (522-632)||(23000229-23000329)
chr8 (598-632)||(27468093-27468127)
chr8 (496-573)||(36918122-36918199)
[»] chr1 (73 HSPs)
chr1 (471-632)||(46247954-46248114)
chr1 (471-619)||(23768334-23768481)
chr1 (450-632)||(34725099-34725278)
chr1 (471-632)||(18944640-18944803)
chr1 (449-632)||(41319807-41319989)
chr1 (471-632)||(27474278-27474437)
chr1 (471-632)||(32632558-32632717)
chr1 (473-632)||(14617037-14617195)
chr1 (471-630)||(46991801-46991959)
chr1 (471-632)||(20004091-20004253)
chr1 (472-632)||(27201645-27201806)
chr1 (471-621)||(6925097-6925246)
chr1 (473-622)||(18724557-18724704)
chr1 (471-632)||(30395727-30395889)
chr1 (471-632)||(10668217-10668384)
chr1 (471-632)||(47214508-47214666)
chr1 (471-630)||(45402092-45402251)
chr1 (496-632)||(35005144-35005282)
chr1 (474-632)||(38478283-38478438)
chr1 (475-629)||(45812541-45812692)
chr1 (469-579)||(4430080-4430189)
chr1 (536-632)||(4349699-4349795)
chr1 (471-632)||(18741958-18742122)
chr1 (472-632)||(6983812-6983969)
chr1 (473-621)||(2435798-2435946)
chr1 (471-632)||(8197040-8197200)
chr1 (472-632)||(19414437-19414594)
chr1 (474-611)||(25468285-25468421)
chr1 (476-632)||(9939463-9939621)
chr1 (474-624)||(19701570-19701720)
chr1 (522-632)||(35253188-35253296)
chr1 (527-632)||(1517312-1517418)
chr1 (496-621)||(45264411-45264537)
chr1 (471-631)||(19932755-19932913)
chr1 (473-621)||(35019229-35019375)
chr1 (473-621)||(35117777-35117927)
chr1 (473-568)||(52910216-52910311)
chr1 (473-568)||(17470411-17470505)
chr1 (522-641)||(31382206-31382324)
chr1 (474-613)||(44485129-44485267)
chr1 (522-632)||(23796512-23796622)
chr1 (473-578)||(34679274-34679378)
chr1 (473-613)||(11596512-11596650)
chr1 (472-583)||(20036218-20036329)
chr1 (471-583)||(22930119-22930228)
chr1 (474-620)||(12126850-12126993)
chr1 (472-631)||(15511150-15511311)
chr1 (473-583)||(33222983-33223092)
chr1 (473-568)||(50760291-50760385)
chr1 (540-630)||(10378738-10378828)
chr1 (473-552)||(25290162-25290242)
chr1 (475-616)||(18335305-18335445)
chr1 (476-561)||(22327101-22327185)
chr1 (474-630)||(39214961-39215117)
chr1 (538-621)||(46859129-46859213)
chr1 (541-632)||(43768205-43768296)
chr1 (543-613)||(15505632-15505702)
chr1 (474-576)||(24564344-24564445)
chr1 (522-619)||(43207542-43207640)
chr1 (509-631)||(22324927-22325049)
chr1 (471-563)||(14987989-14988080)
chr1 (539-632)||(42304208-42304303)
chr1 (526-632)||(20999851-20999957)
chr1 (473-583)||(27136701-27136811)
chr1 (509-627)||(30682848-30682963)
chr1 (475-587)||(19656151-19656263)
chr1 (496-579)||(31272429-31272511)
chr1 (473-543)||(2435983-2436052)
chr1 (790-860)||(10652856-10652926)
chr1 (478-620)||(49722586-49722726)
chr1 (570-632)||(50606498-50606560)
chr1 (496-621)||(23371145-23371268)
chr1 (522-583)||(34149010-34149071)
[»] chr7 (64 HSPs)
chr7 (471-635)||(11617586-11617749)
chr7 (449-632)||(2541020-2541203)
chr7 (448-632)||(32758212-32758393)
chr7 (473-632)||(23419675-23419833)
chr7 (471-641)||(19426882-19427050)
chr7 (471-632)||(42798643-42798803)
chr7 (450-632)||(42805477-42805660)
chr7 (471-632)||(21172010-21172168)
chr7 (471-629)||(33871914-33872070)
chr7 (471-632)||(27629608-27629768)
chr7 (471-631)||(35334818-35334975)
chr7 (451-632)||(47716413-47716595)
chr7 (474-632)||(10693074-10693229)
chr7 (479-632)||(42391101-42391251)
chr7 (471-641)||(43557446-43557618)
chr7 (451-632)||(22698968-22699151)
chr7 (473-613)||(28362165-28362304)
chr7 (450-632)||(48735123-48735303)
chr7 (499-641)||(7879639-7879781)
chr7 (496-632)||(31591110-31591244)
chr7 (471-632)||(34626209-34626368)
chr7 (473-632)||(14099008-14099165)
chr7 (473-632)||(14409025-14409182)
chr7 (473-632)||(19265791-19265947)
chr7 (473-632)||(40463853-40464010)
chr7 (450-632)||(42476826-42477005)
chr7 (473-618)||(42101899-42102044)
chr7 (471-583)||(46354168-46354281)
chr7 (471-621)||(47077867-47078014)
chr7 (473-583)||(48123534-48123643)
chr7 (452-632)||(8148947-8149126)
chr7 (452-568)||(5180222-5180337)
chr7 (473-632)||(29907393-29907552)
chr7 (473-612)||(19266426-19266564)
chr7 (523-632)||(35787270-35787378)
chr7 (472-568)||(7644931-7645026)
chr7 (476-641)||(11741774-11741936)
chr7 (473-638)||(16341254-16341419)
chr7 (497-631)||(18512455-18512588)
chr7 (483-632)||(18747472-18747621)
chr7 (502-621)||(21566439-21566559)
chr7 (522-614)||(38604551-38604642)
chr7 (474-586)||(2662982-2663089)
chr7 (472-582)||(13805077-13805185)
chr7 (535-632)||(23618978-23619075)
chr7 (474-578)||(6736867-6736969)
chr7 (473-568)||(12473280-12473374)
chr7 (554-632)||(27889317-27889395)
chr7 (450-552)||(42495917-42496017)
chr7 (526-583)||(1408485-1408542)
chr7 (471-568)||(1423975-1424071)
chr7 (473-632)||(3469176-3469338)
chr7 (471-568)||(14732888-14732983)
chr7 (471-552)||(18327008-18327087)
chr7 (496-565)||(35203437-35203506)
chr7 (458-628)||(25198683-25198856)
chr7 (473-543)||(1524276-1524345)
chr7 (598-632)||(45018924-45018958)
chr7 (451-540)||(7193039-7193127)
chr7 (471-543)||(7794596-7794667)
chr7 (526-621)||(23231585-23231680)
chr7 (477-583)||(28078182-28078286)
chr7 (598-632)||(36602547-36602581)
chr7 (472-632)||(39123865-39124029)
[»] chr5 (49 HSPs)
chr5 (450-632)||(38879534-38879717)
chr5 (471-642)||(24448864-24449034)
chr5 (450-632)||(41014272-41014452)
chr5 (472-619)||(27328727-27328875)
chr5 (471-632)||(43334176-43334338)
chr5 (471-632)||(4619105-4619267)
chr5 (471-632)||(8169985-8170143)
chr5 (484-632)||(32703411-32703556)
chr5 (473-632)||(28516434-28516593)
chr5 (471-632)||(35710287-35710445)
chr5 (523-632)||(16880648-16880757)
chr5 (475-629)||(30006303-30006456)
chr5 (474-632)||(22187262-22187421)
chr5 (472-620)||(19142956-19143102)
chr5 (522-632)||(7097761-7097870)
chr5 (525-632)||(13801768-13801877)
chr5 (473-610)||(2838754-2838890)
chr5 (444-613)||(22600401-22600569)
chr5 (471-563)||(37024626-37024715)
chr5 (477-633)||(12006328-12006485)
chr5 (529-621)||(43574637-43574729)
chr5 (473-583)||(208977-209086)
chr5 (522-632)||(29334419-29334530)
chr5 (522-630)||(7368422-7368528)
chr5 (522-632)||(20135628-20135740)
chr5 (471-632)||(1565405-1565565)
chr5 (558-632)||(16957374-16957448)
chr5 (477-575)||(34074620-34074717)
chr5 (473-558)||(23974756-23974840)
chr5 (544-632)||(34154815-34154903)
chr5 (496-568)||(42924899-42924971)
chr5 (480-587)||(1405170-1405276)
chr5 (474-632)||(31694109-31694266)
chr5 (473-621)||(39301099-39301246)
chr5 (471-567)||(31299606-31299700)
chr5 (573-629)||(39801591-39801647)
chr5 (523-582)||(36770806-36770864)
chr5 (532-583)||(41425982-41426033)
chr5 (475-613)||(24323725-24323862)
chr5 (475-613)||(24360349-24360486)
chr5 (522-583)||(22907915-22907975)
chr5 (598-639)||(29184055-29184096)
chr5 (496-552)||(22025541-22025597)
chr5 (600-634)||(19438768-19438802)
chr5 (481-582)||(1850624-1850723)
chr5 (540-621)||(9794390-9794471)
chr5 (522-583)||(24903746-24903807)
chr5 (571-632)||(25622533-25622594)
chr5 (599-632)||(32354228-32354261)
[»] chr4 (74 HSPs)
chr4 (449-634)||(6430625-6430808)
chr4 (450-632)||(5648212-5648392)
chr4 (471-632)||(16408602-16408764)
chr4 (471-632)||(44363131-44363293)
chr4 (450-632)||(48598826-48599005)
chr4 (471-630)||(21646938-21647098)
chr4 (471-632)||(47528531-47528689)
chr4 (477-630)||(17043398-17043549)
chr4 (448-632)||(20224935-20225116)
chr4 (471-632)||(11054149-11054307)
chr4 (450-632)||(30639333-30639513)
chr4 (471-635)||(40915803-40915965)
chr4 (522-632)||(20639659-20639770)
chr4 (458-632)||(14983795-14983968)
chr4 (471-632)||(23501767-23501923)
chr4 (473-632)||(35567146-35567304)
chr4 (522-632)||(25629073-25629183)
chr4 (450-632)||(5306661-5306845)
chr4 (472-621)||(19027823-19027971)
chr4 (472-632)||(47443928-47444091)
chr4 (471-632)||(16911536-16911698)
chr4 (519-621)||(51865050-51865152)
chr4 (471-619)||(37494825-37494972)
chr4 (475-632)||(9832314-9832468)
chr4 (475-632)||(30690177-30690340)
chr4 (473-630)||(54966997-54967151)
chr4 (473-580)||(487187-487294)
chr4 (496-631)||(29207900-29208033)
chr4 (473-582)||(39029111-39029220)
chr4 (451-632)||(55830722-55830902)
chr4 (483-624)||(25463108-25463247)
chr4 (471-582)||(14590811-14590922)
chr4 (473-632)||(20908637-20908797)
chr4 (472-568)||(25343162-25343257)
chr4 (480-587)||(7385522-7385628)
chr4 (471-630)||(10660378-10660538)
chr4 (471-630)||(10874523-10874683)
chr4 (530-632)||(12711450-12711553)
chr4 (471-632)||(13256400-13256558)
chr4 (471-633)||(8473620-8473781)
chr4 (522-632)||(20405110-20405223)
chr4 (473-583)||(47441580-47441689)
chr4 (477-632)||(54175043-54175199)
chr4 (451-632)||(55766467-55766647)
chr4 (522-633)||(7909280-7909391)
chr4 (522-633)||(21489111-21489223)
chr4 (480-620)||(41018807-41018945)
chr4 (485-568)||(7038041-7038122)
chr4 (522-621)||(9987846-9987945)
chr4 (476-615)||(49938611-49938746)
chr4 (530-587)||(17079697-17079754)
chr4 (478-629)||(39077800-39077948)
chr4 (471-632)||(30352581-30352752)
chr4 (473-621)||(54730225-54730375)
chr4 (476-581)||(30496374-30496476)
chr4 (522-612)||(49796822-49796911)
chr4 (475-560)||(23580281-23580365)
chr4 (475-632)||(32478793-32478942)
chr4 (473-558)||(42164224-42164307)
chr4 (529-582)||(48327814-48327869)
chr4 (473-542)||(17315389-17315457)
chr4 (571-632)||(38755909-38755970)
chr4 (509-583)||(30581515-30581591)
chr4 (482-617)||(32629285-32629418)
chr4 (473-557)||(43035224-43035307)
chr4 (477-568)||(51420553-51420644)
chr4 (598-641)||(35532092-35532135)
chr4 (598-632)||(11394952-11394986)
chr4 (598-632)||(11404679-11404713)
chr4 (562-632)||(38786673-38786743)
chr4 (598-632)||(40553938-40553972)
chr4 (476-581)||(49938490-49938594)
chr4 (473-543)||(54640429-54640498)
chr4 (571-632)||(33836488-33836549)
[»] chr2 (62 HSPs)
chr2 (471-632)||(8455317-8455477)
chr2 (446-632)||(14530267-14530454)
chr2 (473-632)||(9671156-9671313)
chr2 (471-632)||(11514410-11514569)
chr2 (475-632)||(10543676-10543834)
chr2 (471-632)||(23397740-23397898)
chr2 (471-583)||(12023969-12024079)
chr2 (471-632)||(24200624-24200786)
chr2 (496-624)||(32781298-32781425)
chr2 (450-632)||(21779262-21779441)
chr2 (496-632)||(10546160-10546297)
chr2 (499-632)||(14444730-14444862)
chr2 (471-632)||(17667976-17668136)
chr2 (472-641)||(25249730-25249897)
chr2 (522-632)||(40762235-40762345)
chr2 (449-632)||(25079718-25079901)
chr2 (473-583)||(21377123-21377232)
chr2 (522-632)||(36871517-36871625)
chr2 (471-629)||(7214508-7214667)
chr2 (471-632)||(19977715-19977875)
chr2 (472-632)||(14544038-14544200)
chr2 (453-632)||(17896215-17896394)
chr2 (472-632)||(40416872-40417031)
chr2 (533-632)||(25632544-25632643)
chr2 (473-587)||(23145744-23145857)
chr2 (473-587)||(23557534-23557647)
chr2 (471-632)||(39914307-39914467)
chr2 (473-630)||(4516354-4516510)
chr2 (475-583)||(5450263-5450371)
chr2 (471-632)||(17623538-17623698)
chr2 (471-632)||(27573595-27573754)
chr2 (475-621)||(31158451-31158598)
chr2 (474-617)||(99281-99421)
chr2 (450-583)||(22371010-22371139)
chr2 (522-632)||(30826061-30826169)
chr2 (474-630)||(45235820-45235976)
chr2 (475-632)||(5841006-5841164)
chr2 (471-621)||(26684632-26684783)
chr2 (473-614)||(44521392-44521532)
chr2 (472-632)||(44643497-44643657)
chr2 (473-552)||(29419970-29420048)
chr2 (471-568)||(17705469-17705565)
chr2 (473-613)||(33795261-33795400)
chr2 (486-565)||(19614981-19615059)
chr2 (475-553)||(44604832-44604908)
chr2 (497-573)||(12315712-12315787)
chr2 (471-621)||(24860000-24860147)
chr2 (538-620)||(24890451-24890533)
chr2 (482-583)||(31821393-31821491)
chr2 (547-632)||(13245096-13245181)
chr2 (522-621)||(17471572-17471673)
chr2 (482-583)||(25641487-25641586)
chr2 (474-632)||(4795730-4795889)
chr2 (599-635)||(40579747-40579783)
chr2 (522-565)||(15296475-15296518)
chr2 (598-632)||(8575995-8576029)
chr2 (477-583)||(17380287-17380391)
chr2 (598-632)||(22371212-22371246)
chr2 (936-973)||(9699733-9699770)
chr2 (473-506)||(35017793-35017826)
chr2 (441-494)||(39189559-39189612)
chr2 (931-972)||(40787056-40787097)
[»] chr6 (39 HSPs)
chr6 (471-632)||(12221915-12222078)
chr6 (471-632)||(1354758-1354916)
chr6 (450-632)||(29355856-29356040)
chr6 (471-632)||(1346938-1347096)
chr6 (473-632)||(9161099-9161258)
chr6 (471-626)||(3815084-3815238)
chr6 (474-632)||(32728158-32728314)
chr6 (472-586)||(20400642-20400755)
chr6 (474-632)||(2166411-2166570)
chr6 (474-632)||(2178044-2178203)
chr6 (498-632)||(18277194-18277328)
chr6 (471-568)||(6024207-6024303)
chr6 (471-583)||(1941829-1941940)
chr6 (450-566)||(8409196-8409311)
chr6 (473-587)||(13905026-13905138)
chr6 (475-583)||(28007604-28007711)
chr6 (496-620)||(7947384-7947509)
chr6 (471-611)||(14553486-14553626)
chr6 (473-568)||(12889402-12889496)
chr6 (522-632)||(26097184-26097292)
chr6 (471-632)||(24097555-24097711)
chr6 (471-543)||(24734607-24734678)
chr6 (522-632)||(25557749-25557857)
chr6 (471-620)||(15866052-15866198)
chr6 (483-620)||(23240837-23240971)
chr6 (509-586)||(33138844-33138921)
chr6 (554-632)||(12885967-12886047)
chr6 (531-572)||(24751135-24751176)
chr6 (509-626)||(32579437-32579553)
chr6 (556-632)||(383761-383837)
chr6 (473-545)||(14975168-14975239)
chr6 (475-632)||(23930128-23930283)
chr6 (496-632)||(17432338-17432482)
chr6 (552-641)||(3116121-3116212)
chr6 (473-568)||(2755489-2755583)
chr6 (522-557)||(9671161-9671196)
chr6 (561-632)||(13267788-13267859)
chr6 (475-583)||(32068074-32068179)
chr6 (599-641)||(6808496-6808538)
[»] scaffold0049 (1 HSPs)
scaffold0049 (471-632)||(58951-59113)
[»] scaffold0258 (1 HSPs)
scaffold0258 (473-632)||(13025-13182)
[»] scaffold0168 (1 HSPs)
scaffold0168 (471-632)||(30553-30711)
[»] scaffold0057 (3 HSPs)
scaffold0057 (472-632)||(46806-46965)
scaffold0057 (450-641)||(24764-24949)
scaffold0057 (522-620)||(43683-43780)
[»] scaffold0187 (2 HSPs)
scaffold0187 (458-631)||(10052-10222)
scaffold0187 (458-631)||(20380-20550)
[»] scaffold0311 (1 HSPs)
scaffold0311 (471-620)||(10784-10932)
[»] scaffold1176 (1 HSPs)
scaffold1176 (472-629)||(1591-1745)
[»] scaffold0015 (1 HSPs)
scaffold0015 (509-632)||(48635-48756)
[»] scaffold0223 (1 HSPs)
scaffold0223 (471-632)||(11106-11263)
[»] scaffold0018 (1 HSPs)
scaffold0018 (529-632)||(72868-72971)
[»] scaffold0005 (1 HSPs)
scaffold0005 (471-582)||(226456-226567)
[»] scaffold0036 (1 HSPs)
scaffold0036 (471-587)||(35063-35180)
[»] scaffold0254 (1 HSPs)
scaffold0254 (474-568)||(4134-4227)
[»] scaffold0167 (1 HSPs)
scaffold0167 (509-613)||(23610-23714)
[»] scaffold0180 (1 HSPs)
scaffold0180 (546-632)||(24134-24220)
[»] scaffold0116 (1 HSPs)
scaffold0116 (451-542)||(8848-8935)
[»] scaffold0028 (1 HSPs)
scaffold0028 (528-588)||(32960-33021)
[»] scaffold0954 (1 HSPs)
scaffold0954 (526-621)||(3572-3667)
[»] scaffold0031 (1 HSPs)
scaffold0031 (471-542)||(43103-43173)


Alignment Details
Target: chr3 (Bit Score: 917; Significance: 0; HSPs: 68)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 917; E-Value: 0
Query Start/End: Original strand, 8 - 1059
Target Start/End: Original strand, 33235063 - 33236111
Alignment:
Q  8 aattataagagcaagctagcatatcattgtgaaggaaagaaagaagaagtagaaaaatgggggtacaaggtactttagaatacttgtctgatttactcag 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33235063 aattataagagcaagctagcatatcattgtgaaggaaagaaagaagaagtagaaaaatgggggtacaaggtactttagaatacttgtctgatttactcag 33235162  T
Q  108 tagcacnnnnnnnnnnnngaagaagcaaactcagactgtatctcttaaaatcagaatggactgtgaaggttgtgctcgcaaggttaagcatgttctttct 207  Q
    ||||||            ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33235163 tagcacaaaaaagaaaaagaagaagcaaactcaaactgtatctcttaaaatcagaatggactgtgaaggttgtgctcgcaaggttaagcatgttctttct 33235262  T
Q  208 ggtgttaaaggtactttttcttttcttctatgcttcaaatcactccttaaaatcatcacatcattttaaattgcggttgcagtcgcagttacgttgcaag 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33235263 ggtgttaaaggtactttttcttttcttctatgcttcaaatcactccttaaaatcatcacatcattttaaattgcggttgcagtcgcagttacgttgcaag 33235362  T
Q  308 tcttgatattgcagtaaaatactatcgatgtggcagcaattgcagttgcgacgctgttgtagaaatctctaaaacttttatattgcgcaattgtggttgc 407  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33235363 tcttgatattgcagtaaaatacgatcgatgtggcagcaattgcagttgcgacgctgttgtagaaatctctaaaacttttatattgcgcaattgtggttgc 33235462  T
Q  408 agaccgcaatttaaaattatgcattattgtttttagtttgtttgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcaca 507  Q
    ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||   |||||||||||||||||||||||||||||||||||||||    
T  33235463 agaccgcaatttaaaattatgcattattgtttttagtttatttgagcggaaaccttgatgcagctggtaaagttgttgtcatgtgacatgaaaggtcaca 33235562  T
Q  508 agttcaaatcgtgtaaacagcctcttgtgt-aaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgg 606  Q
    ||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||  |||||| ||||||||||||||    
T  33235563 agttcaaatcgtgtaaagagcctcttgtgtaaaaaaacagggtaagactgtgtacaatacactaaatggtgggaccc-ctcgcagaccttacgtatgcgg 33235661  T
Q  607 gagctttagtgcaccaggttgcccttattgtttttagttcatttattggaaattaatttgaaatttgaacaggagctaagaaagtggacgtggacttgaa 706  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||    
T  33235662 aagctttagtgcaccaggttgcccttattgtttttagttcatttattggaaattaa-ttgaaatttgaacaggagctaagaaagtggatgtggacttgaa 33235760  T
Q  707 gcagcagaaagtaacagtgagtggatatgttgaaccaaagaaagtgttgaaagctgctcaatctacaaagaagaaggttgagctttggccttatgttcca 806  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33235761 gcagcagaaagtaacggtgagtggatatgttgaaccaaagaaagtgttgaaagctgctcaatctacaaagaagaaggttgagctttggccttatgttcca 33235860  T
Q  807 tacactatggtggctcatccttatatttcacaagcctatgataagaaagcacctcctaatatggttagaaaggttggtgacacttccaacataaaagagt 906  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  33235861 tacactatggtggctcatccttatatttcacaagcctatgataagaaagcacctcctaatatggttagaaaggttggcgacacttccaacataaaagagt 33235960  T
Q  907 ccacctttgatgatagctatgttgaaatgttcagtgatgaaaatccaaatgcttgttctattatgtaatcattcattaaaaaatatgtgtgtatgatgat 1006  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  33235961 ccacctttgatgatagctatgttgaaatgttcagtgatgaaaatccaaatgcttgttctattatgtaatcattcatt-aaaaatatgtgtgtatgatgat 33236059  T
Q  1007 taatttctcaccccttatggtaatcaacactttgaggagaaaataatgtaata 1059  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  33236060 taatttctcaccccttatggtaatc-acactttgaggagaaaataatgtaata 33236111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 87; E-Value: 4e-41
Query Start/End: Original strand, 450 - 632
Target Start/End: Complemental strand, 40272994 - 40272813
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||||||| |  | |||||||||||||||||||||||| || |||||||   |||||| || || ||||| ||||||||||||||||||||||    
T  40272994 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-tggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggt 40272896  T
Q  550 aagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||| ||||||||||||||| |||||||||||||| ||| | | || | |||||||||||||||||||||||| ||||||||||    
T  40272895 aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 40272813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 85; E-Value: 6e-40
Query Start/End: Original strand, 441 - 632
Target Start/End: Original strand, 39203482 - 39203670
Alignment:
Q  441 tagtttgtttgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaa 540  Q
    |||||| | ||||||| ||||||| || | || ||||||||||||||||||||| |||||||||||| |||||| || |  |||||||||||||||||||    
T  39203482 tagtttctctgaggggtaaccttggcacaacttgtaaagttgttgtcatgtgac-tgaaaggtcacaggttcaagtccttgaaacagcctcttgtgtaaa 39203580  T
Q  541 aaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |  |||||||||  |||||||||||||| |||||||||||||| ||| | | |||| | |||||||||||||||||||||| ||||||||||    
T  39203581 a--cagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttgccctt 39203670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 83; E-Value: 9e-39
Query Start/End: Original strand, 451 - 621
Target Start/End: Complemental strand, 6412002 - 6411834
Alignment:
Q  451 gaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggta 550  Q
    |||||| |||||||||  | ||||||||||||||||||||| || ||| ||||||   |||||| || |||||||||||||||||||||||| |||||||    
T  6412002 gaggggtaaccttgacgcaactggtaaagttgttgtcatgtaac-tgataggtcatgggttcaagtcttgtaaacagcctcttgtgtaaaaa-cagggta 6411905  T
Q  551 agactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    || ||||||||||||||| ||||| |||||||| ||| ||| |||| ||||||||||||||||||||||||    
T  6411904 aggctgcgtacaatacaccaaatgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcacc 6411834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 83; E-Value: 9e-39
Query Start/End: Original strand, 450 - 632
Target Start/End: Complemental strand, 13628975 - 13628791
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaa-gttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacaggg 548  Q
    ||||||| ||||||| || | |||||||| |||||||||||||||| |||||||||||  |||||| || || |||||||||||||||||| ||||||||    
T  13628975 tgaggggtaaccttggcacaactggtaaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacaggg 13628877  T
Q  549 taagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||| ||||||||||||||| |  ||||||||||||| ||| | | || | |||||||||||||||||||||||| ||||||||||    
T  13628876 taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 13628791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 82; E-Value: 4e-38
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 12914196 - 12914036
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||| |||||||  |||||||||||||||||| || || ||||||||||||||||||||||||||||||| | ||||||||||||| |    
T  12914196 ctggtaaagttgttgtaatgtgacc-gaaaggtcacaagttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggcggcgtacaatacacca 12914098  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||| ||||| ||| ||| || | | ||||||||||||| | |||||| ||||||||||    
T  12914097 aatggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggttgccctt 12914036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 82; E-Value: 4e-38
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 26869703 - 26869862
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |||||||||||| |||||| || || ||||||||||| |||||||| |||||||||| ||||||||||||||| |    
T  26869703 ctggtaaagttgttgtcatgtgac-tgaaaggtcacaggttcaagtcctggaaacagcctctggtgtaaaa-acagggtaaggctgcgtacaatacacca 26869800  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||  | | || | |||||||||||||||| ||||||| ||||||||||    
T  26869801 aatggtgggaccccttgccggaccatgcgtatgcgggagctttggtgcaccgggttgccctt 26869862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 473 - 633
Target Start/End: Original strand, 22609764 - 22609922
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||||||||||||| || ||||| ||  |||||| || || |||||||||||||||||||| |||||||||| ||||||||||||||| |||    
T  22609764 ggtaaagttgttgtcatgtgac-tgtaaggtaacgggttcaagtcttggaaacagcctcttgtgtaaaa-acagggtaaggctgcgtacaatacaccaaa 22609861  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctta 633  Q
    ||||||||||| ||| | | |||| ||||||||||||||| |||||||| |||||||||||    
T  22609862 tggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctta 22609922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 452 - 632
Target Start/End: Complemental strand, 29366902 - 29366721
Alignment:
Q  452 aggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaa 551  Q
    ||||| ||||||| | || |||||||||||||||||||||||| | |||||||||  |||||| || || |||||||||||||| |||||||||||||||    
T  29366902 aggggtaaccttggcgtaactggtaaagttgttgtcatgtgac-taaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaa 29366804  T
Q  552 gactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    | ||||||||||||||| |  ||||||||||||| ||| | | || | |||||| ||||||||||||||||  ||||||||||    
T  29366803 ggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcactgggttgccctt 29366721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 75; E-Value: 6e-34
Query Start/End: Original strand, 473 - 631
Target Start/End: Original strand, 26573125 - 26573282
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||||||| ||||| |||||||||||  |||||| || || |||||||||| |||||||||||||||||||| ||||||||||||||| ||     
T  26573125 ggtaaagttgttgtcacgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaat 26573223  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccct 631  Q
    |||||||||||  || | | || | |||||||| |||||||||||||||||| ||||||    
T  26573224 tggtgggaccccatcccggaccctgcgtatgcgtgagctttagtgcaccaggctgccct 26573282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 46421198 - 46421035
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| | |||||||||  |||||| || || ||||||||||||||||||||||||||||||| ||||||||||||||| |    
T  46421198 ctggtaaagttgttgtcatgtgactt-aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca 46421100  T
Q  571 --aatggtgggaccctttcgcagcccttacgtatgcgggagcttt-agtgcaccaggttgccctt 632  Q
      ||||||||||||| ||| | | || | |||||||||||||||| |||||||| | ||||||||    
T  46421099 ataatggtgggaccccttcccggaccctgcgtatgcgggagctttaagtgcaccggtttgccctt 46421035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 73; E-Value: 9e-33
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 13730765 - 13730603
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  |||||| || || ||||||||||||||||||||||||||||||| ||| ||||||||||| |    
T  13730765 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacca 13730667  T
Q  571 --aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
      ||||||||||||| ||| | | ||   | |||||||||||||||||||||| ||||||||||    
T  13730666 ataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctt 13730603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 474 - 620
Target Start/End: Complemental strand, 34420802 - 34420656
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaa 572  Q
    ||||||||||||||| ||||| |||||||||||  |||||| || || ||||||||||||||||||||||||||||||| |||||||| ||||| | |||    
T  34420802 gtaaagttgttgtcacgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtaccatacaccaaaa 34420704  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    ||||||||||| ||| | | |||| |||||| ||||||||||||||||    
T  34420703 tggtgggaccccttcccggaccttgcgtatgtgggagctttagtgcac 34420656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 70; E-Value: 5e-31
Query Start/End: Original strand, 450 - 631
Target Start/End: Complemental strand, 8247871 - 8247688
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||||||| |  | |||||||||||||||||||||||| |||||||||||  |||||| || || ||||||||||||||||||||||||||||    
T  8247871 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggt 8247773  T
Q  550 aagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagcttt-agtgcaccaggttgccct 631  Q
    |||  |||||||||||||| |  ||||||||||| | ||| | | || | |||||||||||||||| |||||||  |||||||||    
T  8247772 aaggttgcgtacaatacaccaataatggtgggactccttcccggaccctgcgtatgcgggagctttaagtgcactgggttgccct 8247688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 68; E-Value: 8e-30
Query Start/End: Original strand, 450 - 632
Target Start/End: Original strand, 1217065 - 1217244
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||||||| |  | ||||||||||||| ||||||| || |||||||||||  |||||| || || ||||||||||||||||||||  ||||||    
T  1217065 tgaggggtaaccttggcgcaactggtaaagttgtagtcatgtcac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggt 1217161  T
Q  550 aagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||| ||||||||||||||| |||||| ||||||| ||| | | || | | |||||||||||| ||||||||| ||||||||||    
T  1217162 aaggctgcgtacaatacaccaaatggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 1217244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 471 - 584
Target Start/End: Complemental strand, 4495825 - 4495713
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  |||||| || || ||| ||||| ||||||||||||||||||||| ||||||||||||||| |    
T  4495825 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctgaaaatagcctattgtgtaaaaaacagggtaaggctgcgtacaatacacca 4495727  T
Q  571 aatggtgggaccct 584  Q
    ||||||||||||||    
T  4495726 aatggtgggaccct 4495713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 471 - 635
Target Start/End: Complemental strand, 22123076 - 22122915
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||| ||||||||||||||| ||||||||| |  |||||| || || |||||| |||||||||||||  ||||||||| ||||||||||||||| |    
T  22123076 ctggtaaatttgttgtcatgtgac-tgaaaggtcgcgggttcaagtcctggaaacagtctcttgtgtaaaa--cagggtaaggctgcgtacaatacacca 22122980  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcccttatt 635  Q
    ||||||||||||| ||| | | || | | |||||| ||||| ||||||||| |||||||||||||    
T  22122979 aatggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttgcccttatt 22122915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 478 - 629
Target Start/End: Original strand, 7942993 - 7943143
Alignment:
Q  478 agttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtg 577  Q
    ||||||||||||||||| || ||||||||   ||||| || || ||||||| |||||| |||||||||||||||||||||||||||||||  ||||||||    
T  7942993 agttgttgtcatgtgac-tggaaggtcacggattcaagtcctggaaacagcatcttgtctaaaaaacagggtaagactgcgtacaatacatcaaatggtg 7943091  T
Q  578 gga-ccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcc 629  Q
    ||| ||||||| ||| || | |||||||||||||||||||||||  |||||||    
T  7943092 ggatccctttc-cagaccatgcgtatgcgggagctttagtgcactgggttgcc 7943143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 522 - 633
Target Start/End: Complemental strand, 31904968 - 31904856
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtggga-ccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    ||||||||| || |||||||||||||||| ||||||||||||||||| ||||||||||| ||| ||| |||  ||||||| |||||||||||||||||||    
T  31904968 aaacagcctattatgtaaaaaacagggtatgactgcgtacaatacaccaaatggtgggacccccttcccagatcttacgtgtgcgggagctttagtgcac 31904869  T
Q  621 caggttgccctta 633  Q
    |||| ||||||||    
T  31904868 caggctgccctta 31904856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 473 - 632
Target Start/End: Complemental strand, 53996725 - 53996566
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaa 571  Q
    |||||| |||||||||| |||| |||||||||||  |||||| ||||| ||||| ||||||||||||||||||||||||| |||| ||||||||| | ||    
T  53996725 ggtaaatttgttgtcatttgac-tgaaaggtcacgtgttcaagtcgtggaaacaacctcttgtgtaaaaaacagggtaaggctgcttacaatacaccaaa 53996627  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||| ||| | | |  | |||||| ||||||||||||||||| || |||||||    
T  53996626 atggtgggaccccttccctgacactgcgtatgtgggagctttagtgcaccgggctgccctt 53996566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 522 - 632
Target Start/End: Original strand, 54484736 - 54484847
Alignment:
Q  522 aaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    |||||||||||||||||||||| || |||||| ||||||||||||||| |||||||||||||| ||| | | || | |||||||||||||||||||||||    
T  54484736 aaacagcctcttgtgtaaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac 54484835  T
Q  621 caggttgccctt 632  Q
    | ||||||||||    
T  54484836 cgggttgccctt 54484847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 483 - 632
Target Start/End: Original strand, 516417 - 516568
Alignment:
Q  483 ttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaata---cactaaatggtggg 579  Q
    |||||||||||| |||||||||||  |||||| || || ||||||||||||||||||||||||||||||| ||||| ||||||   ||  |||||| |||    
T  516417 ttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgcacaataaaccaaaaaatggcggg 516515  T
Q  580 accctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||| ||| | | || | |||||||||||||||||||||||| ||||||||||    
T  516516 accccttccccgaccctgcgtatgcgggagctttagtgcaccgggttgccctt 516568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 509 - 632
Target Start/End: Original strand, 14986990 - 14987115
Alignment:
Q  509 gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgg 606  Q
    |||||| || || ||||||||||||||||||||||||||||||| ||||||||||||||| |  ||||||||||||| ||| | | |||| | |||||||    
T  14986990 gttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcgg 14987089  T
Q  607 gagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||||| |||| |||||    
T  14987090 gagctttagtgcaccgggtttccctt 14987115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 509 - 632
Target Start/End: Complemental strand, 10795549 - 10795424
Alignment:
Q  509 gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcccttacgtatgcgg 606  Q
    |||||| || || |||||||||||||||||||| |||||||||| |||||||||||||||   |||||||||||||| |||   | || | |||||||||    
T  10795549 gttcaagtcctggaaacagcctcttgtgtaaaagacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgtatgcgg 10795450  T
Q  607 gagctttagtgcaccaggttgccctt 632  Q
    |||||| |||||||||||||||||||    
T  10795449 gagcttcagtgcaccaggttgccctt 10795424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 58; E-Value: 8e-24
Query Start/End: Original strand, 522 - 632
Target Start/End: Complemental strand, 45786327 - 45786215
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca 619  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||   |||||||||||||| ||| | | || | || |||| ||||||||||||||    
T  45786327 aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgca 45786228  T
Q  620 ccaggttgccctt 632  Q
    || ||||||||||    
T  45786227 ccgggttgccctt 45786215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 58; E-Value: 8e-24
Query Start/End: Original strand, 509 - 613
Target Start/End: Original strand, 55401209 - 55401314
Alignment:
Q  509 gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagcccttacgtatgcggg 607  Q
    |||||| || ||||||||||||||||||||||||||||| |||||||||||| |||||| | |||||||||||||| ||| | | |||| ||||||||||    
T  55401209 gttcaagtcctgtaaacagcctcttgtgtaaaaaacaggttaagactgcgtataatacaccaaaatggtgggaccccttctcggaccttccgtatgcggg 55401308  T
Q  608 agcttt 613  Q
    ||||||    
T  55401309 agcttt 55401314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 449 - 632
Target Start/End: Original strand, 16735415 - 16735596
Alignment:
Q  449 ttgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacaggg 548  Q
    |||||||| ||||||| |  | |||||||||||||||||||||||| || || |||||  |||||| || |  ||||||||||||||  |||| ||||||    
T  16735415 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-tgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acaggg 16735512  T
Q  549 taagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||| ||||||||||||||| |||||||||||||| ||| | | |  | ||||||||| ||||| |||||||  ||||||||||    
T  16735513 taaggctgcgtacaatacaccaaatggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgccctt 16735596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 477 - 621
Target Start/End: Complemental strand, 45948996 - 45948850
Alignment:
Q  477 aagttgttgtcatgtgac--atgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatg 574  Q
    |||||||| |||||||||  | | ||||||||  |||||| || || ||||| |||||||||||||||| |||||||| |||| |||||||||| || ||    
T  45948996 aagttgttttcatgtgactgaaggaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaatagggtaaggctgcatacaatacaccaattg 45948897  T
Q  575 gtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||| ||| | | || | ||||||||||||||||||||||||    
T  45948896 gtgggaccccttctcggaccctgcgtatgcgggagctttagtgcacc 45948850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 496 - 629
Target Start/End: Complemental strand, 54374483 - 54374349
Alignment:
Q  496 tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagccc 594  Q
    |||||||||||| |||||| || || ||||| |||||||||||||||| |||||||| ||||||||||| || | |||||||||||||| ||| | | ||    
T  54374483 tgaaaggtcacaggttcaagtcttggaaacaacctcttgtgtaaaaaatagggtaaggctgcgtacaatccaccaaaatggtgggaccccttcccggacc 54374384  T
Q  595 ttacgtatgcgggagctttagtgcaccaggttgcc 629  Q
     | | ||||||||||||||||| ||||||| ||||    
T  54374383 ctgcatatgcgggagctttagttcaccaggctgcc 54374349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 474 - 616
Target Start/End: Original strand, 9607202 - 9607345
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--a 571  Q
    ||||||||||||||||||||| ||||||||||   |||||| || || ||||||||||||| ||||||||||||||||| ||||||| ||||||| |  |    
T  9607202 gtaaagttgttgtcatgtgac-tgaaaggtcatcggttcaagtcctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtagaatacaccaata 9607300  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagt 616  Q
    ||| |||||||| ||| ||| ||   | |||||||||||||||||    
T  9607301 atgttgggaccccttcccagaccccgcatatgcgggagctttagt 9607345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 522 - 632
Target Start/End: Complemental strand, 49013586 - 49013474
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca 619  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||| |  ||||||||||||| ||| | | ||   | || |||||||||||||||||    
T  49013586 aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtgca 49013487  T
Q  620 ccaggttgccctt 632  Q
    || ||||||||||    
T  49013486 ccgggttgccctt 49013474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 52926371 - 52926220
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  |||||| || || |||||||||||||||||         ||||| ||||||||||||||| |    
T  52926371 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctggaaacagcctcttgtgta---------gtaaggctgcgtacaatacacca 52926282  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||| | ||| | | || | |||||||||||||||||| ||||| ||||||||||    
T  52926281 aatggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctt 52926220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 509 - 632
Target Start/End: Original strand, 31592882 - 31593003
Alignment:
Q  509 gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga 608  Q
    |||||| || || ||||||||||||||||||||  ||||||||| ||||||||||||||| |||||||||||| | ||| | | || | | |||||||||    
T  31592882 gttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggactccttcccggaccctgcatatgcggga 31592979  T
Q  609 gctttagtgcaccaggttgccctt 632  Q
    ||| ||||||||| ||||||||||    
T  31592980 gctctagtgcaccgggttgccctt 31593003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 473 - 580
Target Start/End: Complemental strand, 45620988 - 45620881
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaa 571  Q
    |||||||||||||||| ||||| |||||||||||  |||||| |  || |||||||||||||||||||||| ||||||||| ||||||||||||||| ||    
T  45620988 ggtaaagttgttgtcacgtgac-tgaaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaa 45620890  T
Q  572 atggtggga 580  Q
     ||||||||    
T  45620889 ttggtggga 45620881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 476 - 632
Target Start/End: Complemental strand, 5173876 - 5173720
Alignment:
Q  476 aaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa--t 573  Q
    ||||||||||||||||||| |||||||||||  |||||| || || ||||| ||||||||||||||| ||  |||||  ||| | |||||||| |||  |    
T  5173876 aaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaa-caaagtaaggttgcatgcaatacaccaaaaat 5173779  T
Q  574 ggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||| ||| ||| | | |||| |||||||||||||||||||||||| ||||||||||    
T  5173778 ggtggggccccttcccggaccttgcgtatgcgggagctttagtgcaccgggttgccctt 5173720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 449 - 575
Target Start/End: Complemental strand, 7697068 - 7696945
Alignment:
Q  449 ttgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacaggg 548  Q
    |||||||| ||||||| |  | |||||||||||||||||||||||| | |||||||||  |||||| || || |||||| |||||||||||||  |||||    
T  7697068 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-taaaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaa--caggg 7696972  T
Q  549 taagactgcgtacaatacactaaatgg 575  Q
    |||| ||||||||||||||| ||||||    
T  7696971 taaggctgcgtacaatacaccaaatgg 7696945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 474 - 632
Target Start/End: Original strand, 25944468 - 25944626
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa- 572  Q
    ||||||||||||||| ||||| ||||||||||   |||||| || || |||| |||||| ||||||||||| ||| ||| ||| ||||||||||| |||     
T  25944468 gtaaagttgttgtcacgtgac-tgaaaggtcatgggttcaagtcctggaaaccgcctctcgtgtaaaaaactgggcaaggctgagtacaatacaccaaaa 25944566  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||| ||| | | || | |||||| ||||||||||| |||||||| |||||||    
T  25944567 tggtgggaccccttccctgaccctgcgtatgtgggagctttagcgcaccaggctgccctt 25944626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 525 - 614
Target Start/End: Original strand, 9276313 - 9276401
Alignment:
Q  525 cagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagcttta 614  Q
    |||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||| | | || | ||||||||||| |||||    
T  9276313 cagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggt-ggaccctttcccggaccctgcgtatgcgggaacttta 9276401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 471 - 560
Target Start/End: Complemental strand, 10870112 - 10870025
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgta 560  Q
    |||||||||||||||||||||||| |||||||||||  |||||| || || ||||||||||||||||| ||||||||||||| |||||||    
T  10870112 ctggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgta-aaaacagggtaaggctgcgta 10870025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 525 - 632
Target Start/End: Original strand, 15797271 - 15797376
Alignment:
Q  525 cagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccagg 624  Q
    |||||||||||||||||  ||||||||| ||||||||||||||| |||||||||||||| ||| | | || | | |||| ||||||| ||||||||| ||    
T  15797271 cagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccggg 15797368  T
Q  625 ttgccctt 632  Q
    ||||||||    
T  15797369 ttgccctt 15797376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 522 - 633
Target Start/End: Original strand, 31672739 - 31672851
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccct-ttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    ||||||||| || ||||||||||| || |||| |||||||||||||| |||||||||||| || ||| ||   ||||||| |||||||||||||||||||    
T  31672739 aaacagcctattatgtaaaaaacaaggcaagagtgcgtacaatacaccaaatggtgggactctcttcccatatcttacgtgtgcgggagctttagtgcac 31672838  T
Q  621 caggttgccctta 633  Q
    |||| || |||||    
T  31672839 caggctgtcctta 31672851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 473 - 548
Target Start/End: Original strand, 35417914 - 35417988
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacaggg 548  Q
    |||||||||||| ||||||||| ||| ||||||| |||||||||| || |||||||||||||||||||||||||||    
T  35417914 ggtaaagttgttatcatgtgac-tgagaggtcacgagttcaaatcctggaaacagcctcttgtgtaaaaaacaggg 35417988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 486 - 584
Target Start/End: Complemental strand, 54032705 - 54032608
Alignment:
Q  486 tcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccct 584  Q
    ||||||||| || ||||||||  |||||| || || ||||| ||||||||||||||||||||||||| |||| ||||||||||  ||||||||||||||    
T  54032705 tcatgtgac-tggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccgaatggtgggaccct 54032608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 522 - 583
Target Start/End: Original strand, 47624088 - 47624148
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc 583  Q
    |||||||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||||    
T  47624088 aaacagcctcttgtgtaaaa-acagggtaaggctgcgtacaatacaccaaatggtgggaccc 47624148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 534 - 631
Target Start/End: Complemental strand, 353450 - 353351
Alignment:
Q  534 gtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccct 631  Q
    ||||||||||||||||||| ||||||||||||||| |  ||||||||||||| ||| | | ||   | |||||||||||||||||||||| |||||||||    
T  353450 gtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct 353351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 473 - 621
Target Start/End: Original strand, 19731000 - 19731147
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||| ||||||||| ||||  |||||||||||   | ||| || || ||| |||||||||||||||||||| ||||||  ||||||||||||||  |     
T  19731000 ggtaaatttgttgtcacgtgat-tgaaaggtcacggatgcaagtcctggaaatagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacacctat 19731098  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||||||||| ||| |  |  |||||| ||||||||||||||||    
T  19731099 tggtgggaccctttcccagactctgtgtatgcaggagctttagtgcacc 19731147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 540 - 632
Target Start/End: Complemental strand, 34771457 - 34771365
Alignment:
Q  540 aaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||||||||||||||| |||||||||||||| ||| | | || | | |||||||||||| ||||||||| || |||||||    
T  34771457 aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgccctt 34771365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 522 - 632
Target Start/End: Complemental strand, 25517282 - 25517171
Alignment:
Q  522 aaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    ||||| |||||||||||||||| || | || | ||||||||||||||| |||||||||||||| ||| | |  | | ||||||| |||||||||||||||    
T  25517282 aaacatcctcttgtgtaaaaaaacaagatatggctgcgtacaatacacaaaatggtgggaccccttcccggatcctgcgtatgctggagctttagtgcac 25517183  T
Q  621 caggttgccctt 632  Q
    | ||||||||||    
T  25517182 cgggttgccctt 25517171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 558 - 632
Target Start/End: Original strand, 24578007 - 24578081
Alignment:
Q  558 gtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||||||||||||||| ||||| ||| || ||| ||||||||| || ||||||||| ||||||||||    
T  24578007 gtacaatacactaaatggtgggactctttcccagaccctacatatgcgggaactctagtgcaccgggttgccctt 24578081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 477 - 583
Target Start/End: Complemental strand, 30928302 - 30928197
Alignment:
Q  477 aagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggt 576  Q
    ||||| |||||||||||| |||||||||||  |||||| || || |||||||||||||||||||||||| ||||||  || ||| ||||||| || |||     
T  30928302 aagttcttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggtaaggttgtgtaaaatacaccaattggc 30928204  T
Q  577 gggaccc 583  Q
    |||||||    
T  30928203 gggaccc 30928197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 508 - 619
Target Start/End: Complemental strand, 43114995 - 43114882
Alignment:
Q  508 agttcaaatcgtgtaaacagcctcttgtgtaa-aaaacagggtaa-gactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcg 605  Q
    ||||||| || || |||||||||||||||||| |||||||||||| | || | |||||||||| |||||||||||||||| |    ||| | ||||||||    
T  43114995 agttcaagtcctggaaacagcctcttgtgtaaaaaaacagggtaagggctacctacaatacaccaaatggtgggacccttcctggacccctgcgtatgcg 43114896  T
Q  606 ggagctttagtgca 619  Q
    ||||||||||||||    
T  43114895 ggagctttagtgca 43114882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 486 - 632
Target Start/End: Complemental strand, 45139624 - 45139479
Alignment:
Q  486 tcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccc 583  Q
    ||||||||| |||||||||||  |||||| |  || ||||| |||||||||||||| |||||||||| |||| ||||||||||   ||||||||||||||    
T  45139624 tcatgtgac-tgaaaggtcacgggttcaagttttggaaacaacctcttgtgtaaaacacagggtaaggctgcatacaatacaccaaaaatggtgggaccc 45139526  T
Q  584 tttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
     ||| ||| || | ||||||||||| |||| ||||||| || |||||||    
T  45139525 cttcccagacc-tgcgtatgcgggaacttt-gtgcaccgggctgccctt 45139479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 473 - 550
Target Start/End: Original strand, 53062036 - 53062112
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggta 550  Q
    |||||||||||||||||||||| |||||||||||  |||||| || || |||||||||| ||||| ||||||||||||    
T  53062036 ggtaaagttgttgtcatgtgac-tgaaaggtcacgtgttcaagtcctggaaacagcctcctgtgtcaaaaacagggta 53062112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 526 - 621
Target Start/End: Original strand, 19751628 - 19751723
Alignment:
Q  526 agcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||||||||||| || ||||||  ||||||||||||||  | ||||||||||||||| ||| | ||  ||||||  |||||||||||||||    
T  19751628 agcctcttgtgtaaaaatcaaggtaaggttgcgtacaatacacctattggtgggaccctttcccagactttgtgtatgcatgagctttagtgcacc 19751723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 525 - 583
Target Start/End: Complemental strand, 52428585 - 52428527
Alignment:
Q  525 cagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc 583  Q
    ||||||||||||||||| |||||||||| ||||||||||||||| |||| |||| ||||    
T  52428585 cagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatagtggaaccc 52428527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 473 - 621
Target Start/End: Complemental strand, 44403715 - 44403567
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatac-actaa 571  Q
    ||||||||| |||||| ||| | | |||||||||| ||| || || ||  || |||||||||||||||| ||| |||||| ||||| | ||||| || ||    
T  44403715 ggtaaagttattgtcacgtggc-taaaaggtcacaggttaaagtcctgggaatagcctcttgtgtaaaagacaaggtaaggctgcggagaataccacaaa 44403617  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    |||||||||||| ||| | | || ||||||||| | ||||||||||||||    
T  44403616 atggtgggaccccttcccggaccctacgtatgctgaagctttagtgcacc 44403567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 482 - 558
Target Start/End: Original strand, 12525414 - 12525489
Alignment:
Q  482 gttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcg 558  Q
    |||||||| |||| |||||||||||| |||| | || || ||||||||||||||||||||| ||||||||| |||||    
T  12525414 gttgtcatatgac-tgaaaggtcacaggttcgagtcctggaaacagcctcttgtgtaaaaatcagggtaaggctgcg 12525489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 594 - 633
Target Start/End: Complemental strand, 31922878 - 31922839
Alignment:
Q  594 cttacgtatgcgggagctttagtgcaccaggttgccctta 633  Q
    ||||||||||||||||||||||||||||||| ||||||||    
T  31922878 cttacgtatgcgggagctttagtgcaccaggctgccctta 31922839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 558 - 632
Target Start/End: Original strand, 24577917 - 24577991
Alignment:
Q  558 gtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||||||||||||| |||||| ||| || | | ||| |||||||| ||||||||| | ||||||||    
T  24577917 gtacaatacactaaatggtgggatcctttcccagaccctgcatatacgggagctctagtgcaccggattgccctt 24577991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 486 - 583
Target Start/End: Original strand, 33926094 - 33926190
Alignment:
Q  486 tcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta-aatggtgggaccc 583  Q
    ||||||||| ||||||||||   |||||| || || ||| |||||||||||||||| |||||||||| ||| ||||||||||| | |||||||||||||    
T  33926094 tcatgtgac-tgaaaggtcatgggttcaagtcctggaaatagcctcttgtgtaaaa-acagggtaaggctgtgtacaatacaccataatggtgggaccc 33926190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 477 - 567
Target Start/End: Original strand, 39211992 - 39212081
Alignment:
Q  477 aagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca 567  Q
    ||||||| || ||||||| ||||| |||||  |||||| || || ||| | ||||||||||||| |||| |||||||||||||||||||||    
T  39211992 aagttgtcgttatgtgac-tgaaatgtcacgggttcaagtcctggaaataacctcttgtgtaaataacaaggtaagactgcgtacaataca 39212081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 509 - 573
Target Start/End: Original strand, 21875046 - 21875111
Alignment:
Q  509 gttcaaatcgtgtaaacagcctcttgtgt-aaaaaacagggtaagactgcgtacaatacactaaat 573  Q
    ||||||||  || ||||| |||||||||| |||||| |||||||| ||||||||||||||||||||    
T  21875046 gttcaaattctggaaacaacctcttgtgttaaaaaagagggtaaggctgcgtacaatacactaaat 21875111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 598 - 641
Target Start/End: Original strand, 47624221 - 47624264
Alignment:
Q  598 cgtatgcgggagctttagtgcaccaggttgcccttattgttttt 641  Q
    |||||||||||||||||||||||| |||||||||| || |||||    
T  47624221 cgtatgcgggagctttagtgcaccgggttgcccttttttttttt 47624264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 598 - 632
Target Start/End: Complemental strand, 4495711 - 4495677
Alignment:
Q  598 cgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||||||||||||||| ||||||||||    
T  4495711 cgtatgcgggagctttagtgcaccgggttgccctt 4495677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 481 - 582
Target Start/End: Complemental strand, 8411016 - 8410918
Alignment:
Q  481 tgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtggga 580  Q
    |||||||||| ||| |||||||||||  |||||  || || |||| |||||  ||||||||||||||||||| ||||  ||||||||| || ||||||||    
T  8411016 tgttgtcatgggac-tgaaaggtcaccggttcaggtcctggaaactgcctc--gtgtaaaaaacagggtaaggctgctcacaatacaccaactggtggga 8410920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 598 - 632
Target Start/End: Complemental strand, 10484651 - 10484617
Alignment:
Q  598 cgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||||||||||||||| ||||||||||    
T  10484651 cgtatgcgggagctttagtgcaccgggttgccctt 10484617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 598 - 632
Target Start/End: Original strand, 40390363 - 40390397
Alignment:
Q  598 cgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||||||||||||||| ||||||||||    
T  40390363 cgtatgcgggagctttagtgcaccgggttgccctt 40390397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 598 - 632
Target Start/End: Complemental strand, 54032606 - 54032572
Alignment:
Q  598 cgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||||||||||||||| ||||||||||    
T  54032606 cgtatgcgggagctttagtgcaccgggttgccctt 54032572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 100; Significance: 7e-49; HSPs: 53)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 100; E-Value: 7e-49
Query Start/End: Original strand, 430 - 632
Target Start/End: Original strand, 36720728 - 36720930
Alignment:
Q  430 attattgtttttagttt-gtttgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagc 528  Q
    |||||| |||||| ||| |||||||||| ||||||| | || |||||||||||||||||||||||| || ||||||||  |||||| || || |||||||    
T  36720728 attattatttttaatttagtttgaggggtaaccttggcgtaactggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctggaaacagc 36720826  T
Q  529 ctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgc 628  Q
    |||||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||| | | || | ||||||||| |||||||||||||| ||||||    
T  36720827 ctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacccggttgc 36720926  T
Q  629 cctt 632  Q
    ||||    
T  36720927 cctt 36720930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 86; E-Value: 2e-40
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 28817787 - 28817627
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  |||||| || || ||||||||||||||||||||||||||||||| |||||||||||||||      
T  28817787 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccc 28817689  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || | |||||||||||||||||||||| | ||||||||||    
T  28817688 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttgccctt 28817627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 80; E-Value: 6e-37
Query Start/End: Original strand, 471 - 634
Target Start/End: Original strand, 45071239 - 45071400
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||  || ||||||||  |||||| |  || |||||||||||||||||||| |||||||||| ||||||||||||||| |    
T  45071239 ctggtaaagttgttgtcatgtgat-tgtaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaa-acagggtaaggctgcgtacaatacacca 45071336  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcccttat 634  Q
    ||||||||||||| ||| | | |||| ||||||||||||||| |||||||| ||||||||||||    
T  45071337 aatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgcccttat 45071400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 78; E-Value: 9e-36
Query Start/End: Original strand, 472 - 632
Target Start/End: Original strand, 2626494 - 2626656
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaa---aacagggtaagactgcgtacaatacac 568  Q
    |||||||||||||||||||||||  ||||||||||  |||||| || || ||||||||||||||||||||   |||||||||||||||||||||||||||    
T  2626494 tggtaaagttgttgtcatgtgacc-gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaaaacagggtaagactgcgtacaatacac 2626592  T
Q  569 taaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
     ||||| |||||||| ||| ||| || | | ||||||||||||| |||||||||| ||||||||    
T  2626593 caaatgatgggaccccttcccagaccctgcatatgcgggagcttcagtgcaccagattgccctt 2626656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 78; E-Value: 9e-36
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 35261653 - 35261813
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  ||||||  | || |||||| ||||||||||||||||||||||||  |||||||||||||| |    
T  35261653 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagccctggaaacagtctcttgtgtaaaaaacagggtaaggttgcgtacaatacacca 35261751  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| |||   | || | |||||||||||||||||||||||| ||||||||||    
T  35261752 aatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 35261813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 78; E-Value: 9e-36
Query Start/End: Original strand, 450 - 632
Target Start/End: Complemental strand, 39461178 - 39460995
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||||||| |  | |||||||||||||||||||| ||| |||||||||||  |||||| || || ||||||||||||||||||||||||| ||    
T  39461178 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgagac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagt 39461080  T
Q  550 aagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||| ||||||||||||||| |  ||||||| ||||| ||| | | || | |||||||||||||||||||||||| ||||||||||    
T  39461079 aaggctgcgtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 39460995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 75; E-Value: 6e-34
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 12670409 - 12670251
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |||||||||||  |||||| || || ||||||||||||||||||||  ||||||||| ||||||||||||||| |    
T  12670409 ctggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacca 12670313  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || | | |||||||||||| ||||||||| |||| |||||    
T  12670312 aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttaccctt 12670251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 13160676 - 13160835
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  |||||| || |  |||||||||||||||||||| |||||||||| ||||||||||||||| |    
T  13160676 ctggtaaagttgttgtcatgtgac-tgtaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaa-acagggtaaggctgcgtacaatacacca 13160773  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || | ||||||||||||||| ||||| || ||||||||||    
T  13160774 aatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttgccctt 13160835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 475 - 628
Target Start/End: Complemental strand, 29521842 - 29521690
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatg 574  Q
    ||||||||||||| |||||| || ||||||||  |||||| || || |||||||||||||| |||||||||||||||| ||||||||||||||| |||||    
T  29521842 taaagttgttgtcgtgtgac-tggaaggtcacgggttcaagtcctggaaacagcctcttgtttaaaaaacagggtaaggctgcgtacaatacaccaaatg 29521744  T
Q  575 gtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgc 628  Q
    |||||| ||  || ||| || | |||||||||||||||||||||||| ||||||    
T  29521743 gtgggaacccatcccagaccctgcgtatgcgggagctttagtgcaccgggttgc 29521690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 44530123 - 44530283
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||| |||||||||||  ||| ||||||  |||||| || || ||||| ||||||||||||||||||||||||| ||||||||||||||| |    
T  44530123 ctggtaaagttgctgtcatgtgactagaa-ggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca 44530221  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| |||   | || | |||||||||||||||||||||||| ||||| ||||    
T  44530222 aatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgacctt 44530283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 73; E-Value: 9e-33
Query Start/End: Original strand, 449 - 632
Target Start/End: Complemental strand, 30454278 - 30454098
Alignment:
Q  449 ttgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacaggg 548  Q
    |||||||| ||||||| |  | |||||||||||||||||||||||| |||||||||||  |||||| || || ||||||||||||||||||||  || ||    
T  30454278 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--caagg 30454182  T
Q  549 taagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||| |||||||| |||||| |||||||||||||| ||| | | || | | |||||||||||| ||||||||| ||||||||||    
T  30454181 taaggctgcgtacgatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 30454098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 70; E-Value: 5e-31
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 17823550 - 17823710
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    ||||||||||||||||||||||||  ||||||||||  |||||| || || ||||||||||||||||||||| |||| |||||||||||| ||||||| |    
T  17823550 ctggtaaagttgttgtcatgtgacc-gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaccaggataagactgcgtaaaatacacca 17823648  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||| |||| ||| |   || | | ||||| |||||||||||||||| ||||||||||    
T  17823649 aatggtggaaccccttcccgaaccctgcatatgcaggagctttagtgcaccgggttgccctt 17823710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 70; E-Value: 5e-31
Query Start/End: Original strand, 473 - 634
Target Start/End: Original strand, 22598133 - 22598292
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    ||||||||||||||||  |||| |||||||||||  ||||||||| || ||||| ||||||||||||||||||||||||| ||  ||||||||||| ||     
T  22598133 ggtaaagttgttgtcacatgac-tgaaaggtcacgggttcaaatcctggaaacaacctcttgtgtaaaaaacagggtaaggctatgtacaatacaccaat 22598231  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcccttat 634  Q
    ||||| ||||||||| | | |||| ||||||||||| |||||||||||||||  ||||||||    
T  22598232 tggtgagaccctttcccggaccttgcgtatgcggga-ctttagtgcaccaggcagcccttat 22598292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 12625863 - 12626024
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaa-aacagggtaagactgcgtacaatacact 569  Q
    ||||||||||||||||| |||||| || | ||||||  | |||| || || ||||| |||||||||||||| |||||||||||||||| ||||||||||     
T  12625863 ctggtaaagttgttgtcgtgtgacttgta-ggtcacgggctcaagtcctggaaacaacctcttgtgtaaaaaaacagggtaagactgcatacaatacacc 12625961  T
Q  570 aaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||||  || | | || | |||||||||||||||||||||||| ||||||||||    
T  12625962 aaatggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 12626024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 8897925 - 8897765
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    ||||||||||||||||||||||||| | ||||||||  ||| || || || ||||| || ||||||||||||| |||||||| || |||||||||||| |    
T  8897925 ctggtaaagttgttgtcatgtgaca-gcaaggtcacgggttgaagtcctggaaacaaccgcttgtgtaaaaaatagggtaaggctacgtacaatacacca 8897827  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || | | ||||||||||||||| |||||| ||||||||||    
T  8897826 aatggtgggaccccttcccggaccctgcatatgcgggagctttactgcacccggttgccctt 8897765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 522 - 631
Target Start/End: Original strand, 29877118 - 29877227
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||| ||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||| | | || | ||||||||||||| ||||||||||    
T  29877118 aaacagccttttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcgttagtgcacc 29877217  T
Q  622 aggttgccct 631  Q
    ||| ||||||    
T  29877218 aggctgccct 29877227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 6760796 - 6760958
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    ||||||||||||||||||| ||||  ||| ||||||  |||||| || || ||||||||||||||||||||||||||||||| || |||||||||||| |    
T  6760796 ctggtaaagttgttgtcatatgactagaa-ggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggcttcgtacaatacacca 6760894  T
Q  571 --aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
      ||||||||||||| ||| | | ||   | |||||||||||||||||||||| ||||||||||    
T  6760895 ataatggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggttgccctt 6760958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 477 - 629
Target Start/End: Complemental strand, 18164914 - 18164764
Alignment:
Q  477 aagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggt 576  Q
    |||||||||||||||||| |||||||||||  |||||| || || ||||||||||||||||||||| |||||||||  |||||||||||||| ||| | |    
T  18164914 aagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggtaaggttgcgtacaatacaccaaaggat 18164817  T
Q  577 gggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcc 629  Q
    | |||| |||| | | || | |||||||||||||||||||||||| |||||||    
T  18164816 gtgaccatttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 18164764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 472 - 632
Target Start/End: Original strand, 26954107 - 26954269
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacacta 570  Q
    ||||||||||||||||||||||   ||| ||||||  |||||| || || |||||||||||||||||||||| ||||||||| ||||||||||||||| |    
T  26954107 tggtaaagttgttgtcatgtgattagaa-ggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacacca 26954205  T
Q  571 a--atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |  |||||||||||| ||| ||| |||  | |||||||||||||||||||||  ||||||||||    
T  26954206 ataatggtgggaccccttcccagacctcgcatatgcgggagctttagtgcactgggttgccctt 26954269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 62; E-Value: 3e-26
Query Start/End: Original strand, 458 - 632
Target Start/End: Original strand, 25250483 - 25250658
Alignment:
Q  458 aaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgc 557  Q
    ||||||| || | |||||||||||||||||||||||| || ||||||||| |||||| || || ||||||||| |||||||||||| |||||| | ||||    
T  25250483 aaccttggcacaactggtaaagttgttgtcatgtgac-tggaaggtcacatgttcaagtcctggaaacagcctattgtgtaaaaaatagggtatggctgc 25250581  T
Q  558 gtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||| |  ||||||||||||| ||| |   ||   | |||||||||| ||||||||||| ||||||||||    
T  25250582 gtacaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagatttagtgcaccgggttgccctt 25250658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 7136690 - 7136528
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || |||||||   |||||| || || ||||| ||||||||||||||| ||||||||| ||||||||||||||| |    
T  7136690 ctggtaaagttgttgtcatgtgac-tggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaccagggtaaggctgcgtacaatacacca 7136592  T
Q  571 --aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
      ||||||||||||| ||| | | ||   | |||||||||||||||||||||| |||| |||||    
T  7136591 ataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttaccctt 7136528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 473 - 627
Target Start/End: Complemental strand, 20284232 - 20284075
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaaca--gggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||| |||||||||||  |||||| || || |||||||||||||| ||||||| |  ||||||| ||||||||||||||| |    
T  20284232 ggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaagggtaaggctgcgtacaatacacca 20284134  T
Q  571 a--atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttg 627  Q
    |  |||||||||||| ||| | | || | |||||||||||| ||||||||||| |||||    
T  20284133 ataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg 20284075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 473 - 627
Target Start/End: Complemental strand, 21070861 - 21070703
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaaca---gggtaagactgcgtacaatacact 569  Q
    |||||||||||||||||||||| |||||||||||  |||||| || || |||||||||||||| ||||||| |   ||||||| |||||||||||||||     
T  21070861 ggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaaagggtaaggctgcgtacaatacacc 21070763  T
Q  570 aa--atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttg 627  Q
    ||  |||||||||||| ||| | | || | |||||||||||| ||||||||||| |||||    
T  21070762 aataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg 21070703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 473 - 620
Target Start/End: Complemental strand, 44781665 - 44781517
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--ta 570  Q
    |||||||||||||||| ||||| |||||| ||||  |||||| || || ||||| |||||||||||||| |||||||||| ||| |||||||||||   |    
T  44781665 ggtaaagttgttgtcacgtgac-tgaaagttcacgggttcaagtcctggaaacaacctcttgtgtaaaagacagggtaaggctgtgtacaatacaccaaa 44781567  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    |||| ||||||||  || ||| || | |||||||||||||||||||||||    
T  44781566 aatgttgggaccccgtcccagaccctgcgtatgcgggagctttagtgcac 44781517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 509 - 621
Target Start/End: Original strand, 5689642 - 5689754
Alignment:
Q  509 gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga 608  Q
    |||||| || |||||| ||||||||||||||||| ||||||||| ||||||||||||||| ||||||||| |||| ||| |   || | |||||| ||||    
T  5689642 gttcaagtcttgtaaatagcctcttgtgtaaaaagcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaaccatgcgtatgtggga 5689741  T
Q  609 gctttagtgcacc 621  Q
    |||||||||||||    
T  5689742 gctttagtgcacc 5689754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 509 - 621
Target Start/End: Complemental strand, 8484062 - 8483950
Alignment:
Q  509 gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga 608  Q
    |||||| || || ||||| ||||||||||||||||||||| ||| ||||||||||||||| || |||||||||||  || ||| || | |||||||||||    
T  8484062 gttcaagtcctggaaacaacctcttgtgtaaaaaacagggcaaggctgcgtacaatacaccaattggtgggaccccatcccagaccctgcgtatgcggga 8483963  T
Q  609 gctttagtgcacc 621  Q
    ||||||| |||||    
T  8483962 gctttagggcacc 8483950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 509 - 632
Target Start/End: Complemental strand, 5135413 - 5135291
Alignment:
Q  509 gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga 608  Q
    |||||| || || |||||||||||||||||||||| |||||||| ||| ||||||||||| |||||||||||||| ||| | | || | ||||||| |||    
T  5135413 gttcaagtcctggaaacagcctcttgtgtaaaaaagagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcagga 5135314  T
Q  609 gctttagtgcaccaggttgccctt 632  Q
    ||||| ||||||| || |||||||    
T  5135313 gcttt-gtgcaccgggctgccctt 5135291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 522 - 632
Target Start/End: Original strand, 10857852 - 10857963
Alignment:
Q  522 aaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    |||| ||||||||||||||||| ||||||||| ||||| ||||||||| || ||||||||||  |||   | |||| |||||||||||||||||||||||    
T  10857852 aaaccgcctcttgtgtaaaaaaacagggtaaggctgcgcacaatacaccaattggtgggaccacttcctggaccttgcgtatgcgggagctttagtgcac 10857951  T
Q  621 caggttgccctt 632  Q
    | ||||||||||    
T  10857952 cgggttgccctt 10857963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 473 - 582
Target Start/End: Complemental strand, 14018128 - 14018019
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    ||||| |||||||||| ||||  ||||||||||   |||||| || || |||||| ||||||||||||||||||||| ||||||||||||||||||||||    
T  14018128 ggtaatgttgttgtcacgtgat-tgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaaaacagggtgagactgcgtacaatacactaaa 14018030  T
Q  573 -tggtgggacc 582  Q
     ||||||||||    
T  14018029 ttggtgggacc 14018019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 471 - 568
Target Start/End: Complemental strand, 20869657 - 20869563
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    |||||||||||||||||||||||| |||||||||||  |||||| || || ||||||||||||||||  ||||||||||||| ||| |||||||||||    
T  20869657 ctggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaaggctgtgtacaatacac 20869563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 522 - 641
Target Start/End: Original strand, 20869947 - 20870068
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca 619  Q
    |||||| |||||||||||||||||||||||| ||||||||||||||| |  ||||||||||||| |||   | ||   | ||||||||||||||||||||    
T  20869947 aaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagctttagtgca 20870046  T
Q  620 ccaggttgcccttattgttttt 641  Q
    || |||||||||| || |||||    
T  20870047 ccgggttgcccttttttttttt 20870068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 479 - 632
Target Start/End: Original strand, 31457155 - 31457306
Alignment:
Q  479 gttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgg 578  Q
    |||||||||||||| | |||||||||||  |||||| || |||||||| |||||||||||||||  |||  ||| ||||||||||||||  ||||||| |    
T  31457155 gttgttgtcatgtggc-tgaaaggtcacgggttcaagtcctgtaaacaacctcttgtgtaaaaat-aggaaaaggctgcgtacaatacatcaaatggtag 31457252  T
Q  579 gaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||| ||| ||  || | |||||||||||||| ||||||||| | ||||||||    
T  31457253 gaccccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgccctt 31457306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 474 - 613
Target Start/End: Complemental strand, 24365218 - 24365079
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaa 572  Q
    ||||||||||||||||||||| | ||| |||||  ||||||  | |  |||||||||||||||||||||| ||||||||| ||||| ||||||||| |||    
T  24365218 gtaaagttgttgtcatgtgac-taaaatgtcacgggttcaagccctagaaacagcctcttgtgtaaaaaatcagggtaaggctgcgaacaatacaccaaa 24365120  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagcttt 613  Q
    ||||||||||| ||| | | || | |||||| |||||||||    
T  24365119 tggtgggaccccttcccggaccctgcgtatgtgggagcttt 24365079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 524 - 632
Target Start/End: Original strand, 16225045 - 16225155
Alignment:
Q  524 acagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    |||||||||| |||||||||||||||||||||||||||||||||| |  |||||||||| || ||| | | ||   | ||||||||||||||||||||||    
T  16225045 acagcctcttatgtaaaaaacagggtaagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcacc 16225144  T
Q  622 aggttgccctt 632  Q
     ||||| ||||    
T  16225145 gggttgtcctt 16225155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 28407390 - 28407537
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  |||||| || || |||||||||||||||| ||||||||||||||             ||| |    
T  28407390 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaaacagggtaag------------gcacca 28407475  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || ||||||||||||||||||| |||||| ||||||||||    
T  28407476 aatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgccctt 28407537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 471 - 565
Target Start/End: Original strand, 11748273 - 11748366
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaata 565  Q
    ||||| || ||||||||||||||| ||||| |||||  |||||| || || |||||||||||| |||||||| ||||||||||| ||||||||||    
T  11748273 ctggtgaaattgttgtcatgtgac-tgaaatgtcacgggttcaagtcttggaaacagcctcttttgtaaaaagcagggtaagacagcgtacaata 11748366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 533 - 630
Target Start/End: Complemental strand, 44742619 - 44742521
Alignment:
Q  533 tgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccc 630  Q
    |||||||||||||||||||| |||||||||||||| | |||||||||||||| |||   | || |||| |||||||||| |||||||||| || |||||    
T  44742619 tgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcttggaccctacggatgcgggagcattagtgcaccggggtgccc 44742521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 497 - 621
Target Start/End: Original strand, 389642 - 389768
Alignment:
Q  497 gaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgt--aaaaaacagggtaagactgcgtacaatacactaaatggtggga-ccctttcgcagcc 593  Q
    ||||||||||  |||||| || || ||||| ||||||||||  |||||||||||||||  |||||||||||||| ||||| ||||| ||||||| | | |    
T  389642 gaaaggtcacgggttcaagtcctggaaacaccctcttgtgtcaaaaaaacagggtaaggttgcgtacaatacaccaaatgatgggatccctttc-ctgac 389740  T
Q  594 cttacgtatgcgggagctttagtgcacc 621  Q
    | | |||||||| |||||||||||||||    
T  389741 cctgcgtatgcgagagctttagtgcacc 389768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 476 - 559
Target Start/End: Complemental strand, 30962929 - 30962847
Alignment:
Q  476 aaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgt 559  Q
    ||||||||||||||||||  ||||||||||| | ||||| || || |||||||||||||||||||||| ||||| || ||||||    
T  30962929 aaagttgttgtcatgtgat-tgaaaggtcacgacttcaagtcctggaaacagcctcttgtgtaaaaaatagggttaggctgcgt 30962847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 476 - 582
Target Start/End: Original strand, 35105902 - 35106008
Alignment:
Q  476 aaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta-aatg 574  Q
    ||||||||||||| ||| | |||||||||||  |||||| || || ||||| |||||||||||||| | || ||||| ||||||||||||||| | ||||    
T  35105902 aaagttgttgtcacgtggc-tgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaagagagtgtaaggctgcgtacaatacaccagaatg 35106000  T
Q  575 gtgggacc 582  Q
    ||||||||    
T  35106001 gtgggacc 35106008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 525 - 620
Target Start/End: Complemental strand, 17250985 - 17250888
Alignment:
Q  525 cagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    ||||||||||||||||||||||| |||| | ||||||||||||| |  ||||||||||||||||| |   || | ||||||  |||||||||||||||    
T  17250985 cagcctcttgtgtaaaaaacaggttaaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaaggagctttagtgcac 17250888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 524 - 584
Target Start/End: Complemental strand, 23286432 - 23286374
Alignment:
Q  524 acagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccct 584  Q
    ||||||||||||||||||  ||||||||  ||||||||||||||| |||||||||||||||    
T  23286432 acagcctcttgtgtaaaa--cagggtaaagctgcgtacaatacaccaaatggtgggaccct 23286374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 532 - 621
Target Start/End: Complemental strand, 40605006 - 40604918
Alignment:
Q  532 ttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||||||  || ||||  |||||||||||||||||||| |||  ||||| || | |||| |||||||||||||||||||||||||    
T  40605006 ttgtgtaaaaaattggataaggttgcgtacaatacactaaatgatggatcccttccgaaaccct-acgtatgcgggagctttagtgcacc 40604918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 522 - 583
Target Start/End: Original strand, 43942348 - 43942411
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccc 583  Q
    |||||||||||| ||| |||||||||||||| |||||||||||||||   ||||||||||||||    
T  43942348 aaacagcctcttatgtcaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccc 43942411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 473 - 583
Target Start/End: Complemental strand, 11001109 - 11000999
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaa 571  Q
    |||||||||||||||||||||  ||||||||| |  ||||||||  || ||||| |||  ||||||||||| || | |||| ||| ||||||||||| ||    
T  11001109 ggtaaagttgttgtcatgtgat-tgaaaggtcgcgggttcaaattctgaaaacaacctactgtgtaaaaaaacaagataaggctgtgtacaatacaccaa 11001011  T
Q  572 atggtgggaccc 583  Q
    ||||||||||||    
T  11001010 atggtgggaccc 11000999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 931 - 974
Target Start/End: Complemental strand, 40577034 - 40576991
Alignment:
Q  931 aaatgttcagtgatgaaaatccaaatgcttgttctattatgtaa 974  Q
    |||| |||||||||||||||||||||||||||||||| ||||||    
T  40577034 aaattttcagtgatgaaaatccaaatgcttgttctatcatgtaa 40576991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 473 - 583
Target Start/End: Complemental strand, 42083858 - 42083748
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaa 571  Q
    |||||| ||||||||| ||||| |||||||||||  |||||| || || ||||||||| ||||||||||||  ||| ||| ||||||||| || | | ||    
T  42083858 ggtaaaattgttgtcacgtgac-tgaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatggggcaaggctgcgtacagtataccaaa 42083760  T
Q  572 atggtgggaccc 583  Q
    ||||||||||||    
T  42083759 atggtgggaccc 42083748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 559 - 632
Target Start/End: Original strand, 26102578 - 26102651
Alignment:
Q  559 tacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||| |||||||||||||| ||| | | || | | |||||||||||| ||||||||| ||||||||||    
T  26102578 tacaatacaccaaatggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgccctt 26102651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 555 - 632
Target Start/End: Original strand, 16013511 - 16013590
Alignment:
Q  555 tgcgtacaatacactaaa--tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||||||||  ||||| ||||| ||| ||| || | | |||||||||||||||||||||| ||||| ||||    
T  16013511 tgcgtacaatacactaaaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttgtcctt 16013590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 540 - 620
Target Start/End: Original strand, 19729382 - 19729462
Alignment:
Q  540 aaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    ||||||||||||| ||| ||||||||||| |||||||||||||| ||| | | || | | ||| |||||||| ||||||||    
T  19729382 aaaacagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatacgggagctctagtgcac 19729462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 522 - 632
Target Start/End: Complemental strand, 23000329 - 23000229
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||||||||||||||| || ||||||  | | |||||||||| |||||||||||||| |||          || |||||||||||||||||||||    
T  23000329 aaacagcctcttgtgtaaaaa-cacggtaaggttccatacaatacaccaaatggtgggaccccttc---------ccggatgcgggagctttagtgcacc 23000240  T
Q  622 aggttgccctt 632  Q
     ||||||||||    
T  23000239 gggttgccctt 23000229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 598 - 632
Target Start/End: Complemental strand, 27468127 - 27468093
Alignment:
Q  598 cgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||||||||||||||| ||||||||||    
T  27468127 cgtatgcgggagctttagtgcaccgggttgccctt 27468093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 496 - 573
Target Start/End: Original strand, 36918122 - 36918199
Alignment:
Q  496 tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaat 573  Q
    |||||||||||| |||||| |  || |||||   |||| |||||||||||||||||| ||| ||||||||||| ||||    
T  36918122 tgaaaggtcacatgttcaagttctggaaacaatttcttatgtaaaaaacagggtaaggctgtgtacaatacaccaaat 36918199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 94; Significance: 3e-45; HSPs: 73)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 94; E-Value: 3e-45
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 46248114 - 46247954
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| ||||| |||||  |||||| || || ||||||||||||||||||||||||||||||||||||||||||||||| |    
T  46248114 ctggtaaagttgttgtcatgtgac-tgaaatgtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacca 46248016  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || | |||||||||||||||||||| ||| ||||||||||    
T  46248015 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgccctt 46247954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 471 - 619
Target Start/End: Complemental strand, 23768481 - 23768334
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||| |||||| || || ||||||||||||||||||||||||||||||| ||||||||||||||| |    
T  23768481 ctggtaaagttgttgtcatgtgac-tgtaaggtcacaggttcaagtcatggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca 23768383  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca 619  Q
    ||||||||||| | ||| ||| || | ||||||||||||||||||||||    
T  23768382 aatggtgggacaccttcccagaccctgcgtatgcgggagctttagtgca 23768334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 450 - 632
Target Start/End: Complemental strand, 34725278 - 34725099
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||||||| |  | |||||||||||||||||||||||| |||||||||||  |||||| || || ||||||||||||||||||||  ||||||    
T  34725278 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggt 34725182  T
Q  550 aagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||| |||||||||||||||||||||||||||||| ||| | | || | | |||||||||||| ||||||||| ||||||||||    
T  34725181 aaggctgcgtacaatacactaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 34725099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 82; E-Value: 4e-38
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 18944640 - 18944803
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |||||||||||| ||||||  | || ||||||||||||||||||||||||||||||| ||||||||||||||| |    
T  18944640 ctggtaaagttgttgtcatgtgac-tgaaaggtcacaggttcaaggcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca 18944738  T
Q  571 --aatggtgggaccctttcgcagcccttacgtatgcgggagc-tttagtgcaccaggttgccctt 632  Q
      ||||||||||||| ||| | | || | ||||||||||||| ||||||||||| ||||||||||    
T  18944739 acaatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccctt 18944803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 449 - 632
Target Start/End: Complemental strand, 41319989 - 41319807
Alignment:
Q  449 ttgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacaggg 548  Q
    |||||||| |||||||||| | |||||||||||||||||||||||| |||||||||||| ||| || || || |||||| ||||||||||||||||||||    
T  41319989 ttgaggggtaaccttgacacaactggtaaagttgttgtcatgtgac-tgaaaggtcacaggtttaagtcctggaaacagtctcttgtgtaaaaaacaggg 41319891  T
Q  549 taagactgcgtacaatacactaaatggtgggaccctttcgc-agcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||| ||||||||||||||| ||||| |||||||| ||| | | ||||| | |||||||||| || |||||||  ||||||||||    
T  41319890 taaggctgcgtacaatacaccaaatgatgggaccccttcccgaaccctt-catatgcgggagtttcagtgcactgggttgccctt 41319807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 78; E-Value: 9e-36
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 27474278 - 27474437
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |||||||||||| |||||| || || |||||| |||||||||||||| ||||| ||  ||||||||||||||||     
T  27474278 ctggtaaagttgttgtcatgtgac-tgaaaggtcacaggttcaagtcttggaaacagtctcttgtgtaaaaa-cagggcaaagctgcgtacaatacactg 27474375  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || | |||||||||||||||||||||||| | ||||||||    
T  27474376 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccctt 27474437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 78; E-Value: 9e-36
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 32632717 - 32632558
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    ||||||||||||||||||| |||| |||||||||||  |||||| || || ||||||||||||||||||||| ||||||||| ||||||||||||||| |    
T  32632717 ctggtaaagttgttgtcatatgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacacca 32632620  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| ||  || | | ||||||||||||| ||||||||||||| |||||    
T  32632619 aatggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgcaccaggtttccctt 32632558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 473 - 632
Target Start/End: Original strand, 14617037 - 14617195
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||||||||||||| ||||||||||| ||||||| || || ||||||||||||||||||| |||| ||||||  |||||||||||||| |||    
T  14617037 ggtaaagttgttgtcatgtgac-tgaaaggtcacgagttcaagtcctggaaacagcctcttgtgtaaataacaaggtaaggttgcgtacaatacaccaaa 14617135  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||| || ||| | | || | | |||||||||||||||||||||| |||| |||||    
T  14617136 tggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgggttaccctt 14617195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 471 - 630
Target Start/End: Original strand, 46991801 - 46991959
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  |||||| || || ||||| ||||||||||||||||||||||||| ||| |||||||||||      
T  46991801 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccg 46991899  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccc 630  Q
    ||||||||||||| ||| | | || | |||||| ||||||||||||||||| ||||||||    
T  46991900 aatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgggttgccc 46991959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 73; E-Value: 9e-33
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 20004253 - 20004091
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  |||||| || || ||||||||||| |||||||||||| |||||| ||||||||||||||| |    
T  20004253 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctggaaacagcctctcgtgtaaaaaacaaggtaaggctgcgtacaatacacca 20004155  T
Q  571 --aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
      ||||||||||||| ||| ||| ||   | |||||||||||||||||||||| ||||||||||    
T  20004154 ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt 20004091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 472 - 632
Target Start/End: Original strand, 27201645 - 27201806
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--t 569  Q
    ||||||||||||||||||||||| ||||||||||   |||||| || || |||||||||||||||| | |||||||||||| |||||||||||||||       
T  27201645 tggtaaagttgttgtcatgtgac-tgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtcagaaacagggtaaggctgcgtacaatacaccaa 27201743  T
Q  570 aaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||||| ||| | | |||| ||||||||||||||||||||||   ||||||||||    
T  27201744 aaatggtgggaccccttcccggaccttgcgtatgcgggagctttagtgcattgggttgccctt 27201806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 471 - 621
Target Start/End: Original strand, 6925097 - 6925246
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  |||||| || || ||| |||||||||||||||||| |||||||| ||||| |||||||||      
T  6925097 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaatagggtaaggctgcggacaatacaccg 6925195  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||||||| ||| | | || | ||||||||||||||||||||||||    
T  6925196 aatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcacc 6925246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 70; E-Value: 5e-31
Query Start/End: Original strand, 473 - 622
Target Start/End: Complemental strand, 18724704 - 18724557
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||||||||||||| |||||||||||  |||||| || || ||||||||||||||||||||||||||||||| ||| ||||||||||| |||    
T  18724704 ggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaaa 18724606  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacca 622  Q
    |  |||||||| ||| | | || ||| |||||||||||||| ||||||||    
T  18724605 tcttgggaccccttcccggaccctacatatgcgggagcttt-gtgcacca 18724557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 30395889 - 30395727
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| | || ||||||  |||||| || || ||||||||||||||||||||||||||||||| ||||||||||||||| |    
T  30395889 ctggtaaagttgttgtcatgtgactttaa-ggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca 30395791  T
Q  571 --aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
      ||||||||||||| ||| | | ||   | ||||||||||||||||||||||  |||||||||    
T  30395790 ataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccctt 30395727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 68; E-Value: 8e-30
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 10668217 - 10668384
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatga----aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatac 566  Q
    |||||||||||||||||||||||  |||    ||||||||  |||||| || || |||||||||||||||||||||||| ||||||  ||||||||||||    
T  10668217 ctggtaaagttgttgtcatgtgatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatac 10668316  T
Q  567 acta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    || |  ||||||||||||| ||| | | || | |||||||||||||||||||||||| ||||||||||    
T  10668317 accaataatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggttgccctt 10668384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 47214508 - 47214666
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |||||||||||  |||||| || || |||||| ||||||| |||||  |||||||||  |||||||||||||| |    
T  47214508 ctggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagtctcttgtttaaaa--cagggtaaggttgcgtacaatacacca 47214604  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| ||| || | | |||||||||||| ||||||||||| || |||||    
T  47214605 aatggtgggaccccttcccagaccctgcatatgcgggagctctagtgcaccagattaccctt 47214666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 471 - 630
Target Start/End: Original strand, 45402092 - 45402251
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt--aaga-ctgcgtacaataca 567  Q
    |||||||||||||||||||||||  || ||||| ||  |||||| || || ||||||||||||||||||||| ||||||  |||  ||||||||||||||    
T  45402092 ctggtaaagttgttgtcatgtga--tggaaggtaacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggttcaagttctgcgtacaataca 45402188  T
Q  568 ctaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccc 630  Q
    | |||||||||||||| ||| ||| || | |||||||||||||||||||||||| ||||||||    
T  45402189 ccaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgccc 45402251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 496 - 632
Target Start/End: Original strand, 35005144 - 35005282
Alignment:
Q  496 tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcc 593  Q
    |||||||||||  |||||| || || ||||||||||||||||||||||||||||||| |||| ||||||||||   |||||||||||||| ||| | | |    
T  35005144 tgaaaggtcacgggttcaagtcttgaaaacagcctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccggac 35005243  T
Q  594 cttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    | | |||||||||| ||||||||||||| ||||||||||    
T  35005244 cctgcgtatgcgggcgctttagtgcaccgggttgccctt 35005282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 474 - 632
Target Start/End: Complemental strand, 38478438 - 38478283
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaat 573  Q
    ||||| ||||||||||||||| |||||||||||  |||||| || |  ||||||||||||||||||||  ||||||||| ||||||||||||||| ||||    
T  38478438 gtaaacttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaat 38478342  T
Q  574 ggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||| |||| ||| | | || | | |||||||||||| ||||||||| ||||||||||    
T  38478341 ggtggaaccccttctcggaccctgcatatgcgggagctctagtgcaccgggttgccctt 38478283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 475 - 629
Target Start/End: Complemental strand, 45812692 - 45812541
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatg 574  Q
    |||||||||||||||||||| |||||||||||| |||||| || || |||||| ||||||||||||| |  ||||||| |||| |||||||||| |||||    
T  45812692 taaagttgttgtcatgtgac-tgaaaggtcacaggttcaagtcctgaaaacagtctcttgtgtaaaaga--gggtaaggctgcatacaatacaccaaatg 45812596  T
Q  575 gtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcc 629  Q
    ||||||||| ||| ||  || | | |||||||||||| ||||||||| |||||||    
T  45812595 gtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgcc 45812541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 469 - 579
Target Start/End: Complemental strand, 4430189 - 4430080
Alignment:
Q  469 agctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    |||||||||||||||||||||||||| || ||||||||  ||| || || || ||||||  |||||||||||||||||||||||||||||||||||||||    
T  4430189 agctggtaaagttgttgtcatgtgac-tggaaggtcacgggtttaagtcttgaaaacagtatcttgtgtaaaaaacagggtaagactgcgtacaatacac 4430091  T
Q  569 taaatggtggg 579  Q
     ||||||||||    
T  4430090 caaatggtggg 4430080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 536 - 632
Target Start/End: Original strand, 4349699 - 4349795
Alignment:
Q  536 gtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||||||| ||||||||||||||| |||||||||||||| ||| | | || | |||||||||||||||||||||||| ||||||||||    
T  4349699 gtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 4349795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 18742122 - 18741958
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgt-aaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacac 568  Q
    |||||||||||||||||||||||| ||||||||||   ||||||||| ||  |||||| || |||| ||||||| ||||||||| |||||||||||||||    
T  18742122 ctggtaaagttgttgtcatgtgac-tgaaaggtcaagggttcaaatcttgggaaacagtcttttgtataaaaaaacagggtaaggctgcgtacaatacac 18742024  T
Q  569 taaa--tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
     |||  ||||||||||| ||| ||| || | |||||||| ||||||||||||||| |||| |||||    
T  18742023 caaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtttccctt 18741958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 58; E-Value: 8e-24
Query Start/End: Original strand, 472 - 632
Target Start/End: Complemental strand, 6983969 - 6983812
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaa 571  Q
    ||||||||||||||||| ||||| |||||||||||| |||||| || || ||||||||||  || ||||||||||||||||  |||||||||||||| ||    
T  6983969 tggtaaagttgttgtcacgtgac-tgaaaggtcacaggttcaagtcctggaaacagcctc--gtataaaaaacagggtaagtatgcgtacaatacaccaa 6983873  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||| ||  | | || | |||| || |||||||| ||||||| || |||||||    
T  6983872 atggtgggacccctttccggaccctgcgtaggcaggagctttggtgcaccgggctgccctt 6983812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 473 - 621
Target Start/End: Complemental strand, 2435946 - 2435798
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaa 571  Q
    |||||||||||||||| ||||| |||||||||||  |||||| || || |||||||||| ||||| ||||| |||||||| |||||||||||||| | ||    
T  2435946 ggtaaagttgttgtcacgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtgaaaaatagggtaagcctgcgtacaatacaccaaa 2435848  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    |||||||||||| ||  |   || | || |||||||||||||||||||||    
T  2435847 atggtgggacccctttccgtaccctccgcatgcgggagctttagtgcacc 2435798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 8197040 - 8197200
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    ||||| |||||||||||||||||| |||||||||||  |||||| || ||  ||  ||||||||||||||||||| |||||| || |||||| ||||| |    
T  8197040 ctggtcaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggtaattgcctcttgtgtaaaaaacatggtaaggctacgtacagtacacca 8197138  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||| |||||| ||| | | || | ||||||  |||||||||||| ||| ||||||||||    
T  8197139 aatggtaggaccccttctcggaccctgcgtatgttggagctttagtgtaccgggttgccctt 8197200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 472 - 632
Target Start/End: Original strand, 19414437 - 19414594
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaa 571  Q
    |||||||||||||||||| |||| |||||||||||  |||||| || |  ||| |||||||| |||||||  |||| |||| ||||||||||||||| ||    
T  19414437 tggtaaagttgttgtcatatgac-tgaaaggtcacgggttcaagtcctagaaagagcctcttatgtaaaa--caggttaaggctgcgtacaatacaccaa 19414533  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||| ||| |   || | | |||||||||||| ||||||||| ||||||||||    
T  19414534 atggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgccctt 19414594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 474 - 611
Target Start/End: Complemental strand, 25468421 - 25468285
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaat 573  Q
    ||||||||||||||||||||  ||||||||||   |||||| || || ||||| ||||||||||||||| |||||||||  |||||||||||||| ||||    
T  25468421 gtaaagttgttgtcatgtgat-tgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaatcagggtaaggttgcgtacaatacaccaaat 25468323  T
Q  574 ggtgggaccctttcgcagcccttacgtatgcgggagct 611  Q
    ||| |||||  ||| ||| || | ||||||||||||||    
T  25468322 ggttggacctcttcccagaccctgcgtatgcgggagct 25468285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 476 - 632
Target Start/End: Original strand, 9939463 - 9939621
Alignment:
Q  476 aaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa--t 573  Q
    ||||||||||||||||||| ||||||||||| ||||||| || || ||||| |||||||| ||| ||||| ||||||  ||||| |||||||| |||  |    
T  9939463 aaagttgttgtcatgtgac-tgaaaggtcacgagttcaagtcctggaaacaacctcttgtttaagaaacatggtaaggttgcgtgcaatacaccaaaaat 9939561  T
Q  574 ggtgggaccct-ttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||  ||| | | || | |||||||||||||||||||||||| |||| |||||    
T  9939562 ggtgggacccccttctcggaccctgcgtatgcgggagctttagtgcaccgggttaccctt 9939621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 474 - 624
Target Start/End: Original strand, 19701570 - 19701720
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaa 572  Q
    |||||||||||||| |||||| ||||| |||||  ||| || || || |||||||||||||||||||||||  ||||||  || |||||||||| | |||    
T  19701570 gtaaagttgttgtcgtgtgac-tgaaatgtcacgggtttaagtcatgaaaacagcctcttgtgtaaaaaacttggtaaggatgggtacaatacaccaaaa 19701668  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccagg 624  Q
    ||||||| ||| ||| | | || | |||||||||||||||||||||||||||    
T  19701669 tggtggggccccttcccggaccctgcgtatgcgggagctttagtgcaccagg 19701720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 522 - 632
Target Start/End: Complemental strand, 35253296 - 35253188
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||||||||||||||  ||||||||| ||||||||||||||| |||||||||||||| ||| | | || | | |||||||||||| |||||||||    
T  35253296 aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc 35253199  T
Q  622 aggttgccctt 632  Q
     | ||||||||    
T  35253198 ggattgccctt 35253188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 527 - 632
Target Start/End: Complemental strand, 1517418 - 1517312
Alignment:
Q  527 gcctcttgtgt-aaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggt 625  Q
    ||||||||||| |||||||| | |||| ||||||||||||||| || ||||||||||| ||| ||| || | ||||||| |||||||||||||||| |||    
T  1517418 gcctcttgtgttaaaaaacatgataaggctgcgtacaatacaccaattggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggt 1517319  T
Q  626 tgccctt 632  Q
    |||||||    
T  1517318 tgccctt 1517312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 496 - 621
Target Start/End: Complemental strand, 45264537 - 45264411
Alignment:
Q  496 tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagccc 594  Q
    |||||||||||| |||||| || || ||||| ||||||||| ||||||||| ||||| ||| || ||||||| | |||||||||||||| ||| ||| ||    
T  45264537 tgaaaggtcacatgttcaagtcctggaaacaacctcttgtgcaaaaaacagagtaaggctgtgtgcaatacaccaaaatggtgggaccccttctcagacc 45264438  T
Q  595 ttacgtatgcgggagctttagtgcacc 621  Q
     | | ||||||||||||||||||||||    
T  45264437 ctgcatatgcgggagctttagtgcacc 45264411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 471 - 631
Target Start/End: Complemental strand, 19932913 - 19932755
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac-- 568  Q
    |||||||||||||||||||||||| ||||||||||   |||||| |  || | ||| ||| ||||||||||||||||||||| |||||||||||||||      
T  19932913 ctggtaaagttgttgtcatgtgac-tgaaaggtcatgggttcaagt--tggatacaacct-ttgtgtaaaaaacagggtaaggctgcgtacaatacacca 19932818  T
Q  569 taaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccct 631  Q
     |||||||||||||| ||| | | || | |||||||  || | ||||||||||||||||||||    
T  19932817 aaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcaccaggttgccct 19932755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 473 - 621
Target Start/End: Original strand, 35019229 - 35019375
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    ||||||||||||||||  |||| ||||||||||||  ||||| || |||||||| |||||||| |||||| |||  |||| |||| |||||||||| ||     
T  35019229 ggtaaagttgttgtcacatgac-tgaaaggtcacagattcaagtcctgtaaacaacctcttgtataaaaatcagtataaggctgcatacaatacaccaat 35019327  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    |||||||||||  || ||| || | |||||||| |||||||||||||||    
T  35019328 tggtgggaccc-ctcccagaccctgcgtatgcgagagctttagtgcacc 35019375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 473 - 621
Target Start/End: Complemental strand, 35117927 - 35117777
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--ta 570  Q
    |||||||||||||||| ||||| |||||||||||  |||||| || || ||| |||||||||||||||| |||||||||| ||| |||||||||||   |    
T  35117927 ggtaaagttgttgtcacgtgac-tgaaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaatacagggtaaggctgtgtacaatacaccaaa 35117829  T
Q  571 aatggtgggaccctttcgcagcccttacgt-atgcgggagctttagtgcacc 621  Q
    |||| |||||||| ||| | | || | ||| |||| ||||||||||||||||    
T  35117828 aatgatgggaccccttcccggaccctgcgtaatgcaggagctttagtgcacc 35117777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 473 - 568
Target Start/End: Original strand, 52910216 - 52910311
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgt-aaaaaacagggtaagactgcgtacaatacac 568  Q
    |||||||||||||||||||||| |||||||||||| |||||| || || ||||||||||||  || ||||||||||||| ||||| |||||||||||    
T  52910216 ggtaaagttgttgtcatgtgac-tgaaaggtcacaggttcaactcttggaaacagcctcttaggtaaaaaaacagggtaggactgtgtacaatacac 52910311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 473 - 568
Target Start/End: Complemental strand, 17470505 - 17470411
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    |||||||||||||||| ||||| |||| |||||   |||||| || |  ||||||||||||||||||||||||||||||| |||||||||||||||    
T  17470505 ggtaaagttgttgtcacgtgac-tgaatggtcatgggttcaagtcctagaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacac 17470411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 522 - 641
Target Start/End: Complemental strand, 31382324 - 31382206
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||||||||||||||| |||| |||| ||||||||||||||| |||||||||||||| |||   | || | | ||||||||||||||| || |||    
T  31382324 aaacagcctcttgtgtaaaaa-caggataaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcatatgcgggagctttactgtacc 31382226  T
Q  622 aggttgcccttattgttttt 641  Q
     |||||||||| || |||||    
T  31382225 gggttgcccttttttttttt 31382206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 474 - 613
Target Start/End: Complemental strand, 44485267 - 44485129
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaat 573  Q
    ||||||||||||||||||||  |||||||||||  |||  | || || ||||| || ||||||||||| ||| |||||| ||||||||||||||| ||||    
T  44485267 gtaaagttgttgtcatgtgat-tgaaaggtcacgggttatagtcctggaaacaaccacttgtgtaaaagacatggtaaggctgcgtacaatacaccaaat 44485169  T
Q  574 ggtgggaccctttcgcagcccttacgtatgcgggagcttt 613  Q
    ||| |||||| ||| | |  | ||||||||||||||||||    
T  44485168 ggttggaccccttcccggatcctacgtatgcgggagcttt 44485129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 522 - 632
Target Start/End: Original strand, 23796512 - 23796622
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||||||||||||||| ||  |||||  |||||||||||||| |||||||| ||||| ||| ||| || | | ||||| ||||||||||||||||    
T  23796512 aaacagcctcttgtgtaaaaatcaatgtaaggttgcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgctggagctttagtgcacc 23796611  T
Q  622 aggttgccctt 632  Q
     || |||||||    
T  23796612 gggctgccctt 23796622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 473 - 578
Target Start/End: Complemental strand, 34679378 - 34679274
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    ||||||||| |||||||||||| |||||  ||||| |||| | || |  ||||| |||||||||||||||||||||||||||||||||| |||||  |||    
T  34679378 ggtaaagttattgtcatgtgac-tgaaatatcacatgttccattcctagaaacaacctcttgtgtaaaaaacagggtaagactgcgtactatacatcaaa 34679280  T
Q  573 tggtgg 578  Q
    ||||||    
T  34679279 tggtgg 34679274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 473 - 613
Target Start/End: Original strand, 11596512 - 11596650
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||| | ||||||||||| ||||| |||||  |||||| || |  ||||| |||||||||||||| |||||||||| ||||||| ||||||| |||    
T  11596512 ggtaaagtggctgtcatgtgac-tgaaatgtcacgggttcaagtcctagaaacaacctcttgtgtaaaa-acagggtaaggctgcgtataatacaccaaa 11596609  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagcttt 613  Q
    ||||||||||| |||   | || | ||||||||||||||||    
T  11596610 tggtgggaccccttcctggaccctgcgtatgcgggagcttt 11596650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 472 - 583
Target Start/End: Original strand, 20036218 - 20036329
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaa-aaacagggtaagactgcgtacaatacacta 570  Q
    ||||||||||||||||||||||| |||||||||||  |||||| || || |||||  |||||||||||| | | ||||||||| ||||| |||||||| |    
T  20036218 tggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacaaactcttgtgtaaagagaaagggtaagattgcgttcaatacacca 20036316  T
Q  571 aatggtgggaccc 583  Q
    |||||||| ||||    
T  20036317 aatggtggaaccc 20036329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 471 - 583
Target Start/End: Complemental strand, 22930228 - 22930119
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| ||||||||||   |||||| || || ||||||||| |||||| ||||||||||||||  || | ||||||||| |    
T  22930228 ctggtaaagttgttgtcatgtgac-tgaaaggtcatgggttcaagtcctggaaacagccttttgtgt-aaaaacagggtaaggttgtg-acaatacacca 22930132  T
Q  571 aatggtgggaccc 583  Q
    |||||||||||||    
T  22930131 aatggtgggaccc 22930119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 474 - 620
Target Start/End: Complemental strand, 12126993 - 12126850
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaat 573  Q
    |||||||||||||||||| |  |||||||||||  ||| || |  || ||||||| ||||||||||||  ||||||||| ||||||||||||||| ||||    
T  12126993 gtaaagttgttgtcatgtaat-tgaaaggtcacgggtttaagttctggaaacagcttcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaat 12126897  T
Q  574 ggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
     ||||||||| ||| | | || | | |||||||||||| ||||||||    
T  12126896 tgtgggaccccttcccggaccctgcatatgcgggagctgtagtgcac 12126850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 472 - 631
Target Start/End: Complemental strand, 15511311 - 15511150
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcg--tacaataca-c 568  Q
    ||||||||||||||| ||||| | ||||||||||||  || || || || |||| |||||||||||||||||||||||||| |||||  ||||||||| |    
T  15511311 tggtaaagttgttgtaatgtggc-tgaaaggtcacatattgaagtcctggaaaccgcctcttgtgtaaaaaacagggtaaggctgcggatacaatacacc 15511213  T
Q  569 taaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccct 631  Q
     ||||||||| |||| |||   | || | |||||| | ||||||||||||||| || ||||||    
T  15511212 aaaatggtggtaccccttcctggaccctgcgtatgtgtgagctttagtgcaccgggctgccct 15511150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 473 - 583
Target Start/End: Original strand, 33222983 - 33223092
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaa 571  Q
    |||||||||||||||||||||| |||||||||||   || || || || |||||||||||||||| |||||||||| |||  ||||||||||||| | ||    
T  33222983 ggtaaagttgttgtcatgtgac-tgaaaggtcacggatttaagtcatggaaacagcctcttgtgt-aaaaacagggaaaggttgcgtacaatacaccaaa 33223080  T
Q  572 atggtgggaccc 583  Q
    ||||||||||||    
T  33223081 atggtgggaccc 33223092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 473 - 568
Target Start/End: Complemental strand, 50760385 - 50760291
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    |||||||| ||||||||||||| ||| |||||||  |||||| || || ||||||||||||||||| ||||| ||||||| ||||||| |||||||    
T  50760385 ggtaaagtagttgtcatgtgac-tgagaggtcacgggttcaagtcctgaaaacagcctcttgtgtataaaactgggtaaggctgcgtataatacac 50760291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 540 - 630
Target Start/End: Complemental strand, 10378828 - 10378738
Alignment:
Q  540 aaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccc 630  Q
    ||||||||||||| ||||||||||||||| |||||||||||||| |||   | || | | |||||||||||||||||||||| || |||||    
T  10378828 aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgggctgccc 10378738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 473 - 552
Target Start/End: Original strand, 25290162 - 25290242
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaaca--gcctcttgtgtaaaaaacagggtaag 552  Q
    |||||||||||||||||||||| |||||||||||  |||||| || || |||||  ||||||||||||||||||||||||||    
T  25290162 ggtaaagttgttgtcatgtgac-tgaaaggtcacgtgttcaagtcttggaaacacagcctcttgtgtaaaaaacagggtaag 25290242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 475 - 616
Target Start/End: Complemental strand, 18335445 - 18335305
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatg 574  Q
    ||||||| |||||||||| | |||||||||||||||| || || || |||||| ||||||| ||||||  |||||||   |||||||||||||  |||||    
T  18335445 taaagtttttgtcatgtgtc-tgaaaggtcacaagttaaagtcctggaaacagtctcttgtttaaaaattagggtaaagttgcgtacaatacatcaaatg 18335347  T
Q  575 gtgggaccctttcgcagcccttacgtatgcgggagctttagt 616  Q
     ||||||||||||  || || |  |||| |||||||||||||    
T  18335346 atgggaccctttcctagaccatgtgtatacgggagctttagt 18335305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 476 - 561
Target Start/End: Original strand, 22327101 - 22327185
Alignment:
Q  476 aaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtac 561  Q
    ||||||||||||||||||| ||||||||| |  |||||| || || ||||| ||||||||||||||||||||||||| ||| ||||    
T  22327101 aaagttgttgtcatgtgac-tgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtac 22327185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 474 - 630
Target Start/End: Complemental strand, 39215117 - 39214961
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaata-cactaaa 572  Q
    |||||||| |||||| ||||| | ||||||| ||||||||| |  || ||||| ||||||||||||||||| ||||||| ||||||||||||   | |||    
T  39215117 gtaaagttattgtcacgtgac-taaaaggtcccaagttcaagtactggaaacaacctcttgtgtaaaaaactgggtaaggctgcgtacaatattccaaaa 39215019  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccc 630  Q
    ||||||| ||| ||| ||  || | |||||| || |||||||||||||| || |||||    
T  39215018 tggtgggtccccttcccaaaccctgcgtatgtggaagctttagtgcaccgggctgccc 39214961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 538 - 621
Target Start/End: Original strand, 46859129 - 46859213
Alignment:
Q  538 aaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    |||||||||||||||||||||||||||||| | |||||||||||| | ||  ||| |||| |||||| ||||| |||||||||||    
T  46859129 aaaaaacagggtaagactgcgtacaatacaccaaaatggtgggactcattttcaggccttgcgtatgtgggagttttagtgcacc 46859213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 541 - 632
Target Start/End: Original strand, 43768205 - 43768296
Alignment:
Q  541 aaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||| |||| |||||||||| || ||||||||||| ||| ||| || | ||||| ||||||||||| |||||| || |||||||    
T  43768205 aaacagggtaaggctgcctacaatacaccaattggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgccctt 43768296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 543 - 613
Target Start/End: Original strand, 15505632 - 15505702
Alignment:
Q  543 acagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagcttt 613  Q
    |||||||||||||||||||||||||| |||||||||||||| ||| |   || | ||||||||||||||||    
T  15505632 acagggtaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagcttt 15505702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 474 - 576
Target Start/End: Original strand, 24564344 - 24564445
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaat 573  Q
    ||||||||| |||| |||||  ||||||||| ||  ||||| || || ||||| |||||||||||||||||||||||||  |||||||||| ||| ||||    
T  24564344 gtaaagttgatgtcttgtgat-tgaaaggtcgcagattcaagtcttggaaacaacctcttgtgtaaaaaacagggtaagggtgcgtacaattcaccaaat 24564442  T
Q  574 ggt 576  Q
    |||    
T  24564443 ggt 24564445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 522 - 619
Target Start/End: Original strand, 43207542 - 43207640
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa-tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca 619  Q
    ||||| |||||| ||| |||||||||||||||| || |||||||||| ||| ||||||||||  ||| ||| || || ||||||| |||||||||||||    
T  43207542 aaacaacctcttatgtgaaaaacagggtaagacggcatacaatacaccaaattggtgggacctcttcccagaccctatgtatgcgagagctttagtgca 43207640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 509 - 631
Target Start/End: Original strand, 22324927 - 22325049
Alignment:
Q  509 gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaatggtgggaccctttcgcagcccttacgtatgcgg 606  Q
    |||||| || || |||||||||||||||| |||||||||||||| |||| ||||||||||   |||||||||  |||  || | | || | |||||||||    
T  22324927 gttcaagtcttggaaacagcctcttgtgt-aaaaacagggtaaggctgcatacaatacaccaaaaatggtggagccccgtc-ccgaccctgcgtatgcgg 22325024  T
Q  607 gagctttagtgcaccaggttgccct 631  Q
    |||||||||||||||||| ||||||    
T  22325025 gagctttagtgcaccaggctgccct 22325049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 471 - 563
Target Start/End: Complemental strand, 14988080 - 14987989
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaa 563  Q
    ||||||||||||||||||| ||||  ||||| |||||||||||| || || ||||||  |||| ||||||| ||||| |||| ||||||||||    
T  14988080 ctggtaaagttgttgtcatatgactagaaag-tcacaagttcaagtcctgaaaacagtatcttatgtaaaatacaggataaggctgcgtacaa 14987989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 539 - 632
Target Start/End: Complemental strand, 42304303 - 42304208
Alignment:
Q  539 aaaaacagggtaagactgcgtacaatacactaaa--tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||||  |||||||||||||| |||  ||||||||||| ||| | | || | |||||| ||||||||||||||||| | ||||||||    
T  42304303 aaaaacagggtaaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgccctt 42304208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 526 - 632
Target Start/End: Complemental strand, 20999957 - 20999851
Alignment:
Q  526 agcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagc-ccttacgtatgcgggagctttagtgcaccagg 624  Q
    |||| ||||||||||||||| || ||| ||||||||||||||| ||||| |||| ||| ||| | || || | |||| ||||||||||||||||||| ||    
T  20999957 agccacttgtgtaaaaaacaaggcaaggctgcgtacaatacaccaaatgatggggccccttc-cggcaccctgcgtacgcgggagctttagtgcaccggg 20999859  T
Q  625 ttgccctt 632  Q
     |||||||    
T  20999858 ctgccctt 20999851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 473 - 583
Target Start/End: Complemental strand, 27136811 - 27136701
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaa 571  Q
    |||||||||||||||| ||||  || |||| ||| ||||||| |  ||  |||| |||||||||||||||||| ||||||  ||||||||||||| | ||    
T  27136811 ggtaaagttgttgtcacgtgat-tggaaggacacgagttcaagttctgggaacaacctcttgtgtaaaaaacatggtaaggttgcgtacaatacaccaaa 27136713  T
Q  572 atggtgggaccc 583  Q
    ||||||||||||    
T  27136712 atggtgggaccc 27136701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 509 - 627
Target Start/End: Original strand, 30682848 - 30682963
Alignment:
Q  509 gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga 608  Q
    ||||||||| || ||| |||||||||||| ||||||| ||||||| || |||| |||||  |||||||||||||| ||| | | || | |||||||||||    
T  30682848 gttcaaatcctgaaaatagcctcttgtgt-aaaaacaaggtaagattgtgtac-atacaacaaatggtgggaccccttcccggaccgtgcgtatgcggga 30682945  T
Q  609 gctttagtgcaccaggttg 627  Q
    ||||| |||||||| ||||    
T  30682946 gcttt-gtgcaccaagttg 30682963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 475 - 587
Target Start/End: Complemental strand, 19656263 - 19656151
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaat 573  Q
    |||||||||||||  ||||| | ||||||||| || ||||  | || |||||||||||||||||||||||| |||||  ||  |||||||||| | ||||    
T  19656263 taaagttgttgtcgcgtgac-tcaaaggtcactagctcaaggcttggaaacagcctcttgtgtaaaaaacatggtaacgctatgtacaatacaccaaaat 19656165  T
Q  574 ggtgggaccctttc 587  Q
    ||| ||||||||||    
T  19656164 ggtaggaccctttc 19656151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 496 - 579
Target Start/End: Complemental strand, 31272511 - 31272429
Alignment:
Q  496 tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtggg 579  Q
    |||||||||||| |||||| || || ||||| ||||||||||| |||||| |||||| |||||||||  |||  ||||||||||    
T  31272511 tgaaaggtcacaggttcaagtcctggaaacaacctcttgtgta-aaaacatggtaaggctgcgtacagcacatcaaatggtggg 31272429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 473 - 543
Target Start/End: Complemental strand, 2436052 - 2435983
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa 543  Q
    |||||||||||||||| ||||| |||||||||||  |||||| || || ||||| |||| |||||||||||    
T  2436052 ggtaaagttgttgtcacgtgac-tgaaaggtcacgggttcaagtcctggaaacaacctcctgtgtaaaaaa 2435983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 790 - 860
Target Start/End: Original strand, 10652856 - 10652926
Alignment:
Q  790 tttggccttatgttccatacactatggtggctcatccttatatttcacaagcctatgataagaaagcacct 860  Q
    ||||||| ||| |||||||||   |||||||| |||||||||| || ||||| ||||| ||||||||||||    
T  10652856 tttggccatatattccatacaacttggtggcttatccttatatatctcaagcttatgacaagaaagcacct 10652926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 478 - 620
Target Start/End: Complemental strand, 49722726 - 49722586
Alignment:
Q  478 agttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtg 577  Q
    ||||||||||| |||| ||||||||||||  ||| || || |||||||| ||||||||  ||| || ||||||||| ||||||||||| | | | |||||    
T  49722726 agttgttgtcacgtga-atgaaaggtcacgggtttaagtcatgtaaacaacctcttgta-aaataatagggtaagattgcgtacaatatattgattggtg 49722629  T
Q  578 ggaccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    | |||| ||| ||  |||| |||||| || ||||||| |||||    
T  49722628 gaaccccttcccaaaccttgcgtatgtggcagctttaatgcac 49722586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 570 - 632
Target Start/End: Original strand, 50606498 - 50606560
Alignment:
Q  570 aaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||||| ||| | | || | | |||||||||||||||||||||| ||||||||||    
T  50606498 aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt 50606560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 496 - 621
Target Start/End: Original strand, 23371145 - 23371268
Alignment:
Q  496 tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct 595  Q
    |||||||||||  |||||| || |  |||||||| |||| ||||||||| ||| |||  || ||||||||||| ||||| |||||||| ||| ||| ||     
T  23371145 tgaaaggtcacgggttcaagtcctagaaacagccacttgggtaaaaaac-gggcaaggttgtgtacaatacaccaaatgctgggaccccttc-cagaccc 23371242  T
Q  596 tacgtatgcgggagctttagtgcacc 621  Q
    | |||||| || ||||||||||||||    
T  23371243 tgcgtatgtggtagctttagtgcacc 23371268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 522 - 583
Target Start/End: Complemental strand, 34149071 - 34149010
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc 583  Q
    ||||||||||||||||| |||| ||||||||  ||||||||| | || |||||||| |||||    
T  34149071 aaacagcctcttgtgtagaaaatagggtaaggttgcgtacaaaagaccaaatggtgagaccc 34149010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 93; Significance: 1e-44; HSPs: 64)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 93; E-Value: 1e-44
Query Start/End: Original strand, 471 - 635
Target Start/End: Complemental strand, 11617749 - 11617586
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |||||||||||| |||||| || || ||||| ||||||||||||||||||||||||||||||||||||||||| |    
T  11617749 ctggtaaagttgttgtcatgtgac-tgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacacca 11617651  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcccttatt 635  Q
    ||||||||||||| |||   | || | ||||||| ||| |||||||||||| |||||||||||||    
T  11617650 aatggtgggaccccttcctggaccctgcgtatgcaggacctttagtgcaccgggttgcccttatt 11617586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 92; E-Value: 4e-44
Query Start/End: Original strand, 449 - 632
Target Start/End: Complemental strand, 2541203 - 2541020
Alignment:
Q  449 ttgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacaggg 548  Q
    |||||||| ||||||| |  | ||||||||||||||||||||||||  ||||||||||  |||||| || || |||||||||||||||||||||||||||    
T  2541203 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaggg 2541104  T
Q  549 taagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||| |||||||| |||||| |||||||||||||| ||| | | || | |||||||||||||||||||||||| |||| |||||    
T  2541103 taaggctgcgtactatacaccaaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggtttccctt 2541020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 82; E-Value: 4e-38
Query Start/End: Original strand, 448 - 632
Target Start/End: Original strand, 32758212 - 32758393
Alignment:
Q  448 tttgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagg 547  Q
    ||||||||| ||||||| |  | |||||||||||||||||||||||| |||||||||||| |||||| || || ||||||||||||||||||||  ||||    
T  32758212 tttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-tgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaa--cagg 32758308  T
Q  548 gtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||| ||| ||||||||||| |||||||||||||| ||| | | || | | |||||||||||| ||||||||| ||||||||||    
T  32758309 gtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 32758393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 80; E-Value: 6e-37
Query Start/End: Original strand, 473 - 632
Target Start/End: Complemental strand, 23419833 - 23419675
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||| ||||||||||| | |||||||||| |||||| |  || ||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  23419833 ggtaaagttgctgtcatgtgac-taaaaggtcacaggttcaagttctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaa 23419735  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||| |||  || |||| ||| |||||| ||||||||||| | || |||||||    
T  23419734 tggtgggaccccttcctagaccttgcgtgtgcgggggctttagtgcatcgggctgccctt 23419675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 471 - 641
Target Start/End: Complemental strand, 19427050 - 19426882
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    ||||||||||||||||||||||||  ||||||||||  |||||| || || |||||||||||||||||||||| |||||||||||||||||||||||| |    
T  19427050 ctggtaaagttgttgtcatgtgacc-gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaagactgcgtacaatacacca 19426952  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcccttattgttttt 641  Q
    ||||||||||||| ||| | | || | | |||||| |||||| |||||||| |||||||||| || |||||    
T  19426951 aatggtgggaccc-ttctcggaccctgcatatgcgagagcttcagtgcaccgggttgcccttttttttttt 19426882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 78; E-Value: 9e-36
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 42798643 - 42798803
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  |||||| || || |||||| ||||||||||||||||| |||||| ||||||||||||||| |    
T  42798643 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcttggaaacagtctcttgtgtaaaaaacaaggtaaggctgcgtacaatacacca 42798741  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||||||| | | || | | |||||||||||| ||||||| | ||||||||||    
T  42798742 aatggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttgccctt 42798803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 78; E-Value: 9e-36
Query Start/End: Original strand, 450 - 632
Target Start/End: Original strand, 42805477 - 42805660
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||||||| | || |||||||||||||||||||||||| || ||||||||  |||||| || || ||||||||||||||||||||||||||||    
T  42805477 tgaggggtaaccttggcgtaactggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggt 42805575  T
Q  550 aagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||| ||| ||||||||||| |  ||||||||||||| ||| | | ||   | |||||||||||||||||||||| ||||||||||    
T  42805576 aaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctt 42805660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 75; E-Value: 6e-34
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 21172168 - 21172010
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    ||||||||||||||||||||| || |||||||||||  |||||| || || ||||||||||||||||||||  ||||||||| ||||||||||||||| |    
T  21172168 ctggtaaagttgttgtcatgtaac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacca 21172072  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || | | |||||||||||| ||||||||| ||||||||||    
T  21172071 aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 21172010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 75; E-Value: 6e-34
Query Start/End: Original strand, 471 - 629
Target Start/End: Complemental strand, 33872070 - 33871914
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| ||||||||| |  |||||| || || ||||| ||||||||||||||| |||| |||| ||||||||||||||| |    
T  33872070 ctggtaaagttgttgtcatgtgac-tgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaa-caggataaggctgcgtacaatacacca 33871973  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcc 629  Q
    ||||||||||||| ||| ||| || |  ||||||| |||||||||||||||||||||||    
T  33871972 aatggtgggaccccttcccagaccctgtgtatgcgagagctttagtgcaccaggttgcc 33871914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 70; E-Value: 5e-31
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 27629608 - 27629768
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    ||||||||||||||||||| ||||  ||||||||||  |||||| || || |||||||||||||||||||||||||||||||  |||||| ||||||| |    
T  27629608 ctggtaaagttgttgtcatttgacc-gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtaaaatacacca 27629706  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || | | ||||||| ||||| |||||||| ||||||||||    
T  27629707 aatggtgggaccccttcccgggccctgcatatgcggtagcttcagtgcaccgggttgccctt 27629768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 70; E-Value: 5e-31
Query Start/End: Original strand, 471 - 631
Target Start/End: Complemental strand, 35334975 - 35334818
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || |||||||| ||||||| || || |||||| |||  ||||||||||||||||||||||| |||||||||||      
T  35334975 ctggtaaagttgttgtcatgtgac-tggaaggtcacgagttcaagtcctggaaacagtctc--gtgtaaaaaacagggtaagactgtgtacaatacaccg 35334879  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccct 631  Q
    ||||||||||||| ||| | | || | ||||||| |||||||||||||||| |||| ||||    
T  35334878 aatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggtttccct 35334818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 451 - 632
Target Start/End: Original strand, 47716413 - 47716595
Alignment:
Q  451 gaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggta 550  Q
    |||||| ||||||| || | |||| |||||||||| |||||||| || ||||||||  |||||| || || |||||||||||||||||||||||||||||    
T  47716413 gaggggtaaccttggcacaactggaaaagttgttgccatgtgac-tggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta 47716511  T
Q  551 agactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    || ||||||||||||||| |  ||||||||||||| ||| | | ||   | |||||||||||||| ||||||| ||||||||||    
T  47716512 aggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggttgccctt 47716595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 68; E-Value: 8e-30
Query Start/End: Original strand, 474 - 632
Target Start/End: Complemental strand, 10693229 - 10693074
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaat 573  Q
    ||||||||||||||||||||| |||||||||||  |||||| || || |||||||||||||||||||| |  ||||||| ||||||||||||||| ||||    
T  10693229 gtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaga--gggtaaggctgcgtacaatacaccaaat 10693133  T
Q  574 ggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||| ||| | | || | | |||||||||||| ||||||||  ||||||||||    
T  10693132 ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcactgggttgccctt 10693074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 479 - 632
Target Start/End: Complemental strand, 42391251 - 42391101
Alignment:
Q  479 gttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgg 578  Q
    |||||||||||||||| |||||||||||  |||||| || || ||||||| ||||||||||||  ||||||||| ||||||||||||||| |||||||||    
T  42391251 gttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcttcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgg 42391155  T
Q  579 gaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||| ||| | | || | | |||||||||||| ||||||||| ||||||||||    
T  42391154 gaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 42391101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 471 - 641
Target Start/End: Original strand, 43557446 - 43557618
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| ||||||||||   |||||| || || ||||||||||||||||||||||||| ||||| ||||||||||||||| |    
T  43557446 ctggtaaagttgttgtcatgtgac-tgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacacca 43557544  T
Q  571 --aatggtgggaccctttcgcagcccttacgtatgcgggagc-tttagtgcaccaggttgcccttattgttttt 641  Q
      |||||||||||||  || | | |  | ||||||||||||| ||||||||||| |||||||||| || |||||    
T  43557545 ataatggtgggaccccctcccggactctgcgtatgcgggagcttttagtgcaccgggttgcccttttttttttt 43557618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 451 - 632
Target Start/End: Complemental strand, 22699151 - 22698968
Alignment:
Q  451 gaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggta 550  Q
    |||||| |||||||||  | |||||||||||||||||||||||| |||||||| |   |||||| || || ||| || ||||||||||||||||||||||    
T  22699151 gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgac-tgaaaggttatgggttcaagtcctggaaatagtctcttgtgtaaaaaacagggta 22699053  T
Q  551 agactgcgtacaatacac--taaatggtgggaccc-tttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||||||||   |||||||||||||| |||| | | || |  ||||||||||||| ||||||||| |||| |||||    
T  22699052 agactgcgtacaatacaccaaaaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtgcaccgggttaccctt 22698968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 473 - 613
Target Start/End: Complemental strand, 28362304 - 28362165
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||||||||||| | |||||||||||| |||||| || |  |||| ||||||||||||||||||  |||||| ||||||||||||||| |||    
T  28362304 ggtaaagttgttgtcatgtggc-tgaaaggtcacaggttcaagtcctagaaactgcctcttgtgtaaaaaacttggtaaggctgcgtacaatacaccaaa 28362206  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagcttt 613  Q
    ||||||||||| ||| ||| |||| | |||| |||||||||    
T  28362205 tggtgggaccccttcccagaccttgcatatgtgggagcttt 28362165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 450 - 632
Target Start/End: Complemental strand, 48735303 - 48735123
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgt-gtaaacagcctcttgtgtaaaaaacaggg 548  Q
    ||||||| ||||||| |  | |||||||||||||||||||||||| |||||||||||  |||||| || | | ||||| |||||||||||||| ||  ||    
T  48735303 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtccttggaaacaacctcttgtgtaaaacac--gg 48735207  T
Q  549 taagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||| ||||||||||||||| |||||||||||||| ||| | | || | | |||||||||||| ||||||||| ||||||||||    
T  48735206 taaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 48735123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 499 - 641
Target Start/End: Original strand, 7879639 - 7879781
Alignment:
Q  499 aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac 598  Q
    ||||||||  |||||| || || |||||  ||||||||||||||||| |||||| ||||||||||||||| |||||||||||||| ||| | | || | |    
T  7879639 aaggtcacgggttcaagtcctggaaacaatctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc 7879738  T
Q  599 gtatgcgggagctttagtgcaccaggttgcccttattgttttt 641  Q
    |||||||||||||| |||||||| |||||||||| || |||||    
T  7879739 gtatgcgggagcttcagtgcaccgggttgcccttttttttttt 7879781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 62; E-Value: 3e-26
Query Start/End: Original strand, 496 - 632
Target Start/End: Complemental strand, 31591244 - 31591110
Alignment:
Q  496 tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct 595  Q
    ||||||||||| ||||||| || || ||||| ||||||||||||||  ||| ||||| |||||||||||||| ||||||||||||||| ||| | | |||    
T  31591244 tgaaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaa--cagagtaaggctgcgtacaatacaataaatggtgggaccccttcccggacct 31591147  T
Q  596 tacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    | | |||||||||||| ||||||||| ||||||||||    
T  31591146 tgcatatgcgggagctctagtgcaccgggttgccctt 31591110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 62; E-Value: 3e-26
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 34626368 - 34626209
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||  ||||||| ||||  ||||| || || |||||||||| |||||||||| ||||||||| |||||| |||||||| |    
T  34626368 ctggtaaagttgttgtcatgtgat-tgaaaggccacagattcaagtcctggaaacagcctcctgtgtaaaaa-cagggtaaggctgcgttcaatacacca 34626271  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||| || ||| | | || | ||||||||||||||||||| || | ||||||||||    
T  34626270 aatggtgggatcccttcccggaccctgcgtatgcgggagctttagttcatcgggttgccctt 34626209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 60; E-Value: 5e-25
Query Start/End: Original strand, 473 - 632
Target Start/End: Complemental strand, 14099165 - 14099008
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||||||||||||| ||||||||||   ||| || || || ||| ||||| |||||||||||||||| |||||||||||||||||||| |||    
T  14099165 ggtaaagttgttgtcatgtgac-tgaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaa 14099067  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||| ||| |   || ||||||||| |||| |||  ||||||||| |||||||    
T  14099066 tggtgggaccccttcccgaaccctacgtatgcaggagattt-ttgcaccaggctgccctt 14099008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 60; E-Value: 5e-25
Query Start/End: Original strand, 473 - 632
Target Start/End: Complemental strand, 14409182 - 14409025
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||||||||||||| ||||||||||   ||| || || || ||| ||||| |||||||||||||||| |||||||||||||||||||| |||    
T  14409182 ggtaaagttgttgtcatgtgac-tgaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaa 14409084  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||| ||| |   || ||||||||| |||| |||  ||||||||| |||||||    
T  14409083 tggtgggaccccttcccgaaccctacgtatgcaggagattt-ttgcaccaggctgccctt 14409025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 60; E-Value: 5e-25
Query Start/End: Original strand, 473 - 632
Target Start/End: Original strand, 19265791 - 19265947
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||||||| ||||| |||||||||||  |||||| || || | |||||| ||||||||||||  |||||||| ||||||||||||||| |||    
T  19265791 ggtaaagttgttgtcacgtgac-tgaaaggtcacgggttcaagtcttggatacagccgcttgtgtaaaaag-agggtaaggctgcgtacaatacaccaaa 19265888  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||| ||| | | || ||| |||| ||||||||||||||||| || |||||||    
T  19265889 tggtgggaccccttcccggacc-tacatatgtgggagctttagtgcaccgggctgccctt 19265947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 60; E-Value: 5e-25
Query Start/End: Original strand, 473 - 632
Target Start/End: Original strand, 40463853 - 40464010
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||||||||||||| || ||||||||  |||||| || |  |||||| |||||||||||||| | ||||||| ||||||| ||||||| |||    
T  40463853 ggtaaagttgttgtcatgtgac-tgtaaggtcacgggttcaagtcatagaaacagtctcttgtgtaaaaa-ctgggtaaggctgcgtataatacaccaaa 40463950  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||| ||| | | || | ||||||||||||||| ||||||||  |||||||||    
T  40463951 tggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccgagttgccctt 40464010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 60; E-Value: 5e-25
Query Start/End: Original strand, 450 - 632
Target Start/End: Original strand, 42476826 - 42477005
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||| ||| | || |||||||||||||||||||||||| | |||||||||   ||||| |  || |||||| |||||||||||||  || |||    
T  42476826 tgaggggtaacattggcgtaactggtaaagttgttgtcatgtgac-taaaaggtcacggattcaagttctggaaacagtctcttgtgtaaaa--caaggt 42476922  T
Q  550 aagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||| ||||||||||||||| |||||||||||||| |||  || |  | | |||||||||||| ||||||||||||||||||||    
T  42476923 aaggctgcgtacaatacaccaaatggtgggaccccttcctaggctctgcatatgcgggagctctagtgcaccaggttgccctt 42477005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 473 - 618
Target Start/End: Complemental strand, 42102044 - 42101899
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||||||| ||||| || ||||||| |||||||| || || ||||||||||||  |||||||||||||||| |||||||||| ||| |||||    
T  42102044 ggtaaagttgttgtcacgtgac-tggaaggtcaaaagttcaagtcctggaaacagcctcttccgtaaaaaacagggtaacactgcgtacagtactctaaa 42101946  T
Q  573 -tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgc 618  Q
     ||||||||||||||| | | || | ||||| ||| |||||||||||    
T  42101945 gtggtgggaccctttcccggaccctgcgtatccggcagctttagtgc 42101899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 471 - 583
Target Start/End: Original strand, 46354168 - 46354281
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||  || ||||||||  |||||| || || ||||| ||||||||||||||||||||||||| ||||||||||||||| |    
T  46354168 ctggtaaagttgttgtcatgtgat-tggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca 46354266  T
Q  571 --aatggtgggaccc 583  Q
      |||||||||||||    
T  46354267 ataatggtgggaccc 46354281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 471 - 621
Target Start/End: Complemental strand, 47078014 - 47077867
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |||||||||||  |||||| || || |||||| ||||||||||||| | ||  |||   |||||||||||||| |    
T  47078014 ctggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaatagag--taaagttgcgtacaatacacaa 47077918  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||||||| ||| ||  || ||| |||||||||||| |||||||||    
T  47077917 aatggtgggaccccttcccaaaccctacatatgcgggagctctagtgcacc 47077867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 473 - 583
Target Start/End: Complemental strand, 48123643 - 48123534
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||| ||||||| | ||||||||||   |||||| || || ||||||||||||||||||| |||||||||| ||||| |||||||||| |||    
T  48123643 ggtaaagttgttatcatgtgtc-tgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaataacagggtaaaactgcatacaatacaccaaa 48123545  T
Q  573 tggtgggaccc 583  Q
    |||||||||||    
T  48123544 tggtgggaccc 48123534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 452 - 632
Target Start/End: Complemental strand, 8149126 - 8148947
Alignment:
Q  452 aggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgt-aaaaaacagggta 550  Q
    ||||| ||||||| || | ||||||| |||||||||||||||| || || ||||| ||||||| || || ||||  |||||||||| |||||| ||||||    
T  8149126 aggggtaaccttggcacaactggtaatgttgttgtcatgtgac-tgcaaagtcacgagttcaagtcctgaaaactacctcttgtgttaaaaaatagggta 8149028  T
Q  551 agactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||  |||||||||||||| |||||||||||||| ||| |||  ||| |||||||| ||| ||||||||| ||| || |||||    
T  8149027 aggttgcgtacaatacaccaaatggtgggaccccttcccag-acttgcgtatgcgagagttttagtgcatcagattaccctt 8148947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 452 - 568
Target Start/End: Complemental strand, 5180337 - 5180222
Alignment:
Q  452 aggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaa 551  Q
    ||||| |||||||||  | |||||||||||||||||||||||| ||||||||||   |||||| |  || |||||||||||||||| |||||||||||||    
T  5180337 aggggtaaccttgacgcaactggtaaagttgttgtcatgtgac-tgaaaggtcaagggttcaacttctggaaacagcctcttgtgtcaaaaacagggtaa 5180239  T
Q  552 gactgcgtacaatacac 568  Q
    ||||| |||||| ||||    
T  5180238 gactgtgtacaacacac 5180222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 473 - 632
Target Start/End: Original strand, 29907393 - 29907552
Alignment:
Q  473 ggtaaagttgttgt--catgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ct 569  Q
    ||||||||||||||  |||||||| |||||||||||  |||||| || |  |||||||||||||||||||||| || ||||| |||||| ||||||| |     
T  29907393 ggtaaagttgttgtatcatgtgac-tgaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaatagtgtaaggctgcgttcaatacacca 29907491  T
Q  570 aaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||||  || | | || |  ||||||||||||||||||||||| ||||||||||    
T  29907492 aaatggtgggaccccatcccggaccct--gtatgcgggagctttagtgcaccgggttgccctt 29907552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 473 - 612
Target Start/End: Original strand, 19266426 - 19266564
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||||||||||||| |||||||||    |||||| || || ||| |||| |||| ||||||||||||||||| ||||||||||||||| |||    
T  19266426 ggtaaagttgttgtcatgtgac-tgaaaggtcgtgggttcaagtcctgaaaatagccacttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaa 19266524  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctt 612  Q
    | |||||| || ||| | | || | |||||||||||||||    
T  19266525 ttgtgggatcccttcccggaccctgcgtatgcgggagctt 19266564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 523 - 632
Target Start/End: Complemental strand, 35787378 - 35787270
Alignment:
Q  523 aacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacca 622  Q
    |||||||||||||||||||| || ||||||  |||||||||||||| |||||| ||||||| ||| | | |||| ||||||||||||||| | ||||||     
T  35787378 aacagcctcttgtgtaaaaa-catggtaaggttgcgtacaatacaccaaatggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccg 35787280  T
Q  623 ggttgccctt 632  Q
    ||||||||||    
T  35787279 ggttgccctt 35787270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 472 - 568
Target Start/End: Original strand, 7644931 - 7645026
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    ||||||| ||||||| | ||||| |||||||||||  |||||| || || ||||||||||||||||||||||||||||||||  |||||||||||||    
T  7644931 tggtaaatttgttgtaacgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagatagcgtacaatacac 7645026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 476 - 641
Target Start/End: Original strand, 11741774 - 11741936
Alignment:
Q  476 aaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatgg 575  Q
    ||||||||||||||||||| ||||||||||   |||||| || || ||||||| ||| |||||||| |  ||||||| ||||||||||||||| ||||||    
T  11741774 aaagttgttgtcatgtgac-tgaaaggtcatgggttcaagtcctgaaaacagcttctagtgtaaaata--gggtaaggctgcgtacaatacaccaaatgg 11741870  T
Q  576 tgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcccttattgttttt 641  Q
    ||||| || ||| | |    | |  ||||||||||| ||||||||| |||||||||||| ||||||    
T  11741871 tgggatcccttcccggattctgcacatgcgggagctctagtgcaccgggttgcccttatagttttt 11741936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 473 - 638
Target Start/End: Original strand, 16341254 - 16341419
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaa 571  Q
    |||||||||||| |||||| |  |||||||||||  |||||| |  |  ||||||||||||||||||||||||||||||| || ||||||||||| | ||    
T  16341254 ggtaaagttgttatcatgt-atttgaaaggtcacgggttcaagttctagaaacagcctcttgtgtaaaaaacagggtaaggctacgtacaatacaccaaa 16341352  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcccttattgtt 638  Q
    |||||||| ||  ||| | | |||  | |||||||||||||| ||||||| || |||||||| ||||    
T  16341353 atggtgggccctcttcccggacctatcatatgcgggagctttggtgcaccgggctgcccttaatgtt 16341419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 497 - 631
Target Start/End: Complemental strand, 18512588 - 18512455
Alignment:
Q  497 gaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccctt 596  Q
    ||||||||||  |||||| || || ||||| | |||||||||||||  |||||||| |||||||||||||||  ||||||||||||| ||| | | || |    
T  18512588 gaaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttcccggaccct 18512490  T
Q  597 acgtatgcgggagctttagtgcaccaggttgccct 631  Q
     |||||||||||||||| ||||||  |||||||||    
T  18512489 gcgtatgcgggagctttggtgcactgggttgccct 18512455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 483 - 632
Target Start/End: Original strand, 18747472 - 18747621
Alignment:
Q  483 ttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaatggtgggac 581  Q
    |||||| ||||| |||||||||||  | |||| || || ||||||||| |||||||||||| ||||||||| ||||||| ||||||| || |||||||||    
T  18747472 ttgtcacgtgac-tgaaaggtcacgggatcaagtcttggaaacagccttttgtgtaaaaaagcagggtaaggctgcgtataatacaccaattggtgggac 18747570  T
Q  582 cctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    || |||     || | |||||||||||||||||||||||| || |||||||    
T  18747571 cccttcctgaaccctgcgtatgcgggagctttagtgcaccgggctgccctt 18747621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 502 - 621
Target Start/End: Original strand, 21566439 - 21566559
Alignment:
Q  502 gtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagcccttacgt 600  Q
    |||||| |||||| || || |||| |||||||||||||||||||| | |||||||||||||||||| | ||||||| |||||| ||| |   || | | |    
T  21566439 gtcacaggttcaagtcttggaaaccgcctcttgtgtaaaaaacagaggaagactgcgtacaatacaccaaaatggtaggaccccttcccgaaccctgcat 21566538  T
Q  601 atgcgggagctttagtgcacc 621  Q
    |||||||||||||||||||||    
T  21566539 atgcgggagctttagtgcacc 21566559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 522 - 614
Target Start/End: Original strand, 38604551 - 38604642
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagcttta 614  Q
    |||||||||||||||||||| |||||||||| ||||||||||||||| |||||||| ||||| ||  | | || | |||||||||||||||||    
T  38604551 aaacagcctcttgtgtaaaa-acagggtaaggctgcgtacaatacaccaaatggtgagacccctttccggaccctgcgtatgcgggagcttta 38604642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 474 - 586
Target Start/End: Complemental strand, 2663089 - 2662982
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaat 573  Q
    ||||||||||||| |||||||  ||   |||| | |||||| || || |||||||||||||||||||| |  ||||||| ||||||||||||||| ||||    
T  2663089 gtaaagttgttgttatgtgactgga---gtcataggttcaagtcctggaaacagcctcttgtgtaaaata--gggtaaggctgcgtacaatacaccaaat 2662995  T
Q  574 ggtgggacccttt 586  Q
    |||||||||||||    
T  2662994 ggtgggacccttt 2662982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 472 - 582
Target Start/End: Original strand, 13805077 - 13805185
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaa 571  Q
    ||||||||||||||||||||||| |||||||| ||  |||||| || || ||| ||||||| |||||||| |  ||||||| ||| ||||||||||| ||    
T  13805077 tggtaaagttgttgtcatgtgac-tgaaaggtaacgggttcaagtcctggaaatagcctctggtgtaaaacag-gggtaaggctgtgtacaatacaccaa 13805174  T
Q  572 atggtgggacc 582  Q
    |||||||||||    
T  13805175 atggtgggacc 13805185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 535 - 632
Target Start/End: Complemental strand, 23619075 - 23618978
Alignment:
Q  535 tgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||| ||||||| |||||  || ||||||||||  |||||||||||||| ||||||| |||| ||| ||| |||||||||||||| | ||||||||||    
T  23619075 tgtataaaacagagtaagcttgtgtacaatacatcaaatggtgggaccccttcgcagaccttgcgtttgcaggagctttagtgcagcgggttgccctt 23618978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 474 - 578
Target Start/End: Original strand, 6736867 - 6736969
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaat 573  Q
    ||||||||||||||||| ||| |||||||||||  |||||| || |  ||||| |||||||| |||||| || ||||||||||| |||||||||| ||||    
T  6736867 gtaaagttgttgtcatgcgac-tgaaaggtcacgggttcaagtcctcaaaacaacctcttgtataaaaa-caaggtaagactgcatacaatacaccaaat 6736964  T
Q  574 ggtgg 578  Q
    |||||    
T  6736965 ggtgg 6736969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 473 - 568
Target Start/End: Original strand, 12473280 - 12473374
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    |||||||||||||||||||  | ||||||||||   |||||| || || ||||| |||||||||| ||||||||||||||  ||||||||||||||    
T  12473280 ggtaaagttgttgtcatgtatc-tgaaaggtcatgggttcaagtcctgcaaacaacctcttgtgtcaaaaacagggtaaggatgcgtacaatacac 12473374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 554 - 632
Target Start/End: Complemental strand, 27889395 - 27889317
Alignment:
Q  554 ctgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||||| |||||||||||||| ||| | | || | |||||||||||||||| || |||| ||||||||||    
T  27889395 ctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgccctt 27889317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 450 - 552
Target Start/End: Complemental strand, 42496017 - 42495917
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||||||| |  | ||||||||||||||||||| |||| |||||||||||  |||||| || || |||||||||||||| | |||||||||||    
T  42496017 tgaggggtaaccttggcgcaactggtaaagttgttgtcatatgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtat-aaaaacagggt 42495920  T
Q  550 aag 552  Q
    |||    
T  42495919 aag 42495917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 526 - 583
Target Start/End: Original strand, 1408485 - 1408542
Alignment:
Q  526 agcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc 583  Q
    |||||||||||||||||||| |||||| ||| ||||||||||  ||||||||||||||    
T  1408485 agcctcttgtgtaaaaaacaaggtaaggctgtgtacaatacagcaaatggtgggaccc 1408542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 471 - 568
Target Start/End: Complemental strand, 1424071 - 1423975
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    |||||||||||||||| ||||||| || ||||||||   |||||||| || |||||| || ||||||||||||||||||||  |||| |||| |||||    
T  1424071 ctggtaaagttgttgttatgtgac-tggaaggtcacggattcaaatcctggaaacagtctgttgtgtaaaaaacagggtaatgctgcatacactacac 1423975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 473 - 632
Target Start/End: Complemental strand, 3469338 - 3469176
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa--cagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||| ||||||||||||   |||| || |  |||||  |||||||||||||||  ||||||| |  |||||||||||||| |    
T  3469338 ggtaaagttgttgtcatgtgac-tgaaaggtcacagactcaagtcctagaaacattctcttgtgtaaaaaaaacagggtacggttgcgtacaatacacca 3469240  T
Q  571 aa--tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||  ||| ||||||| |||  || || |  |||||||||||||||||||| |  ||||||||||    
T  3469239 aaaatggcgggaccccttcctagaccctgtgtatgcgggagctttagtgcgctgggttgccctt 3469176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 471 - 568
Target Start/End: Complemental strand, 14732983 - 14732888
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    |||||||||||||||||||||||| ||||| ||||   |||||| || || ||||||||||   |||||||||||||||||| |||||| ||||||||    
T  14732983 ctggtaaagttgttgtcatgtgac-tgaaaagtcatgggttcaagtcctggaaacagcctcccatgtaaaaaacagggtaaggctgcgt-caatacac 14732888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 471 - 552
Target Start/End: Original strand, 18327008 - 18327087
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaag 552  Q
    |||||||||||||||||||||||| || ||||||||  |||||| ||  | |||||||||||||||| ||||||||||||||    
T  18327008 ctggtaaagttgttgtcatgtgacttg-aaggtcacgggttcaagtcccggaaacagcctcttgtgt-aaaaacagggtaag 18327087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 496 - 565
Target Start/End: Original strand, 35203437 - 35203506
Alignment:
Q  496 tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaata 565  Q
    |||||||||||  |||||| || || |||||  ||||||||||||||||||| |||||||||||||||||    
T  35203437 tgaaaggtcacgggttcaagtcctggaaacattctcttgtgtaaaaaacaggataagactgcgtacaata 35203506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 458 - 628
Target Start/End: Original strand, 25198683 - 25198856
Alignment:
Q  458 aaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaa---tcgtgtaaacagcctcttgtgtaaaaaa-cagggtaaga 553  Q
    ||||||| | || ||||||||||||||||||| |||| |||||| |||   | |||||   || || |||||| || |||||||||||| || |||||||    
T  25198683 aaccttggcgtaactggtaaagttgttgtcatatgac-tgaaagatcatgggatcaaaaagtcttggaaacagtcttttgtgtaaaaaaacaaggtaaga 25198781  T
Q  554 ctgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgc 628  Q
    | ||||| ||| ||||||||||| ||| || ||| ||| || | |||||| | ||||||||||||||| ||||||    
T  25198782 ccgcgtataatgcactaaatggtaggatcccttcccagacccttcgtatgtgagagctttagtgcaccgggttgc 25198856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 473 - 543
Target Start/End: Complemental strand, 1524345 - 1524276
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa 543  Q
    |||||||| ||||||| | ||| ||||||||||||||||||| || | |||||||||||||||||| ||||    
T  1524345 ggtaaagtggttgtcacgagac-tgaaaggtcacaagttcaagtcttataaacagcctcttgtgtataaaa 1524276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 598 - 632
Target Start/End: Complemental strand, 45018958 - 45018924
Alignment:
Q  598 cgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||||||||||||||||||||||||||    
T  45018958 cgtatgcgggagctttagtgcaccaggttgccctt 45018924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 451 - 540
Target Start/End: Original strand, 7193039 - 7193127
Alignment:
Q  451 gaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaa 540  Q
    |||||| ||||||| | || || ||||||||||||||||||||| |||||||||||  |||||| || |  ||||| |||||||||||||    
T  7193039 gaggggtaaccttggcgtaacttgtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaa 7193127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 471 - 543
Target Start/End: Complemental strand, 7794667 - 7794596
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa 543  Q
    |||||||||||||||| ||||||| || ||||||||  |||||| || || |||||||||||| |||||||||    
T  7794667 ctggtaaagttgttgttatgtgac-tggaaggtcacgggttcaagtcctggaaacagcctcttatgtaaaaaa 7794596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 526 - 621
Target Start/End: Original strand, 23231585 - 23231680
Alignment:
Q  526 agcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    |||||||||||||||| | | |||||| ||||||| |||||||  |||| |||||||| ||| |   || | ||||||||| ||||||||||||||    
T  23231585 agcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcacc 23231680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 477 - 583
Target Start/End: Complemental strand, 28078286 - 28078182
Alignment:
Q  477 aagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggt 576  Q
    |||||||||||||||||| || ||||||||  |||||| || |  |||||| ||| |||  |||||||||||||||  ||| | |||||||| |||||||    
T  28078286 aagttgttgtcatgtgac-tgtaaggtcacgggttcaagtcctagaaacagtctcgtgta-aaaaaacagggtaaggttgcatgcaatacaccaaatggt 28078189  T
Q  577 gggaccc 583  Q
    |||||||    
T  28078188 gggaccc 28078182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 598 - 632
Target Start/End: Original strand, 36602547 - 36602581
Alignment:
Q  598 cgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||||||||||||||| ||||||||||    
T  36602547 cgtatgcgggagctttagtgcaccgggttgccctt 36602581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 472 - 632
Target Start/End: Original strand, 39123865 - 39124029
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt----aagactgcgtacaataca 567  Q
    ||||||||||||||||||||||| ||||| | |||  |||||| || |  |||| | ||||||||| |||||||||||    ||| ||||||| ||||||    
T  39123865 tggtaaagttgttgtcatgtgac-tgaaacgacacgggttcaagtcctagaaacggtctcttgtgt-aaaaacagggtagggaaggctgcgtaaaataca 39123962  T
Q  568 c--taaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |   |||||||||||||| ||| | | || | |||||| ||||||||| |||||||| | |||||||    
T  39123963 ccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccaagctgccctt 39124029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 86; Significance: 2e-40; HSPs: 49)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 86; E-Value: 2e-40
Query Start/End: Original strand, 450 - 632
Target Start/End: Original strand, 38879534 - 38879717
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||||||| |  | |||||||||||||||||||||||| |||||||||||  |||||| || || |||||||||||||| |||||||||||||    
T  38879534 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggt 38879632  T
Q  550 aagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||| ||||||||||||||| |  ||||||||||||| ||| | | || | |||||||||||||||||||||||| ||||||||||    
T  38879633 aaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 38879717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 471 - 642
Target Start/End: Original strand, 24448864 - 24449034
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  |||||| || || ||||||||| |||||||||||| |||||||| ||||||||||||||| |    
T  24448864 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatagggtaaggctgcgtacaatacacca 24448962  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcccttattgttttta 642  Q
    ||||||||||||| ||| | | || | ||||||| |||||||||||||||| |||||||||| || ||||||    
T  24448963 aatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgcccttttttttttta 24449034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 75; E-Value: 6e-34
Query Start/End: Original strand, 450 - 632
Target Start/End: Original strand, 41014272 - 41014452
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||||||| |  | |||||||||||||||||||||||| || ||||||||  |||||| || || |||||||||||||||||||| |||||||    
T  41014272 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-acagggt 41014369  T
Q  550 aagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||| ||||||||||||||| |||||||||||||| |||   | ||   | |||||||||||||||||||||| ||||||||||    
T  41014370 aaggctgcgtacaatacaccaaatggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggttgccctt 41014452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 472 - 619
Target Start/End: Original strand, 27328727 - 27328875
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta- 570  Q
    ||||||||||||||||||||||| |||||||||||| |||||| || || |||||| |||||||||||||||||||||||| ||||||||||||||| |     
T  27328727 tggtaaagttgttgtcatgtgac-tgaaaggtcacaggttcaagtcctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaa 27328825  T
Q  571 -aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca 619  Q
     ||||||||||||| ||| |   || | ||||||||||||||||| ||||    
T  27328826 taatggtgggaccccttcccgaaccctgcgtatgcgggagctttaatgca 27328875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 70; E-Value: 5e-31
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 43334176 - 43334338
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacact 569  Q
    |||||||||||||||||||||||| |||||||||||  |||||| || || |||||||||| ||||||||||| ||||||||| |||||||||||||||     
T  43334176 ctggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaaacagggtaaggctgcgtacaatacacc 43334274  T
Q  570 aaa--tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||  ||||||||||| ||| | | || | || ||||||||||||||||||||| ||||||||||    
T  43334275 aaaaatggtgggaccccttcccggaccctgcg-atgcgggagctttagtgcaccgggttgccctt 43334338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 4619267 - 4619105
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  |||||| || || ||| ||||||||||||||||||||||||||| ||||||||||||||| |    
T  4619267 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca 4619169  T
Q  571 --aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
      ||||||||||||| ||| | | ||   | |||||| ||||||||||||||| ||||||||||    
T  4619168 ataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgccctt 4619105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 8170143 - 8169985
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    ||||||||||||||||||||||||  ||||||||||  |||||| || || ||||||||| ||||||||||  ||||||||| ||||||||||||||| |    
T  8170143 ctggtaaagttgttgtcatgtgacc-gaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaa--cagggtaaggctgcgtacaatacacca 8170047  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || | | |||||||||| || |||||||| ||||||||||    
T  8170046 aatggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgccctt 8169985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 484 - 632
Target Start/End: Original strand, 32703411 - 32703556
Alignment:
Q  484 tgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc 583  Q
    ||||||||||| |||||||||||  |||||| || || ||||||||||||||||||||  ||||||||| ||||||||||||||| ||||||||||||||    
T  32703411 tgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccc 32703507  T
Q  584 tttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
     ||| | | || | | |||||||||||| ||||||||| ||||||||||    
T  32703508 cttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 32703556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 65; E-Value: 5e-28
Query Start/End: Original strand, 473 - 632
Target Start/End: Complemental strand, 28516593 - 28516434
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaa 571  Q
    |||||||||||||||| ||| | |||||||||||  |||||| || || ||||| |||||||||||||||||||| || | |||||||||||||| | ||    
T  28516593 ggtaaagttgttgtcaggtggc-tgaaaggtcacgggttcaagtcttggaaacatcctcttgtgtaaaaaacaggctagggctgcgtacaatacatcaaa 28516495  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||| ||| ||| || | || |||| |||||||||||| ||||||||||||||    
T  28516494 atggtgggacccattcccagaccctgcgcatgcaggagctttagtggaccaggttgccctt 28516434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 35710287 - 35710445
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    ||||||||||||||||||||| || |||||||||||  |||||| || || |||||||||||||||||||| |  ||||||| |||||| |||||||| |    
T  35710287 ctggtaaagttgttgtcatgtaac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaata--gggtaaggctgcgttcaatacacca 35710383  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | |  | | | |||||||||||| ||||||||| ||||||||||    
T  35710384 aatggtgggaccccttcccggaacatgcatatgcgggagctctagtgcaccgggttgccctt 35710445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 62; E-Value: 3e-26
Query Start/End: Original strand, 523 - 632
Target Start/End: Complemental strand, 16880757 - 16880648
Alignment:
Q  523 aacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacca 622  Q
    |||||||||||||||||||||||||||||| ||||||||||||||| |||||||| ||||  ||| | | || | ||||||||||||||||||||||||     
T  16880757 aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccg 16880658  T
Q  623 ggttgccctt 632  Q
    |||| |||||    
T  16880657 ggtttccctt 16880648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 475 - 629
Target Start/End: Original strand, 30006303 - 30006456
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatg 574  Q
    |||| ||||||||||||||| |||||||||| |  ||||| ||  | ||||| |||||| | |||| ||||||||||| ||| ||||| |||||||||||    
T  30006303 taaatttgttgtcatgtgac-tgaaaggtcatagattcaagtccggaaaacaacctcttatataaacaacagggtaaggctgtgtacattacactaaatg 30006401  T
Q  575 gtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcc 629  Q
    ||||||||| ||| | |  | || ||||||||||||||||||||||| |||||||    
T  30006402 gtgggaccccttcccggggcctatgtatgcgggagctttagtgcaccgggttgcc 30006456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 474 - 632
Target Start/End: Original strand, 22187262 - 22187421
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taa 571  Q
    |||||||||||||||| |||| |||||||||||  ||| || || || |||||||||||||||||||||||| | ||||||||||||||||||||   ||    
T  22187262 gtaaagttgttgtcatttgac-tgaaaggtcaccggtttaagtcctggaaacagcctcttgtgtaaaaaacatgataagactgcgtacaatacaccaaaa 22187360  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |   || ||||| ||| ||  || ||| ||||| |||||||||||||| ||||||||||||    
T  22187361 acaatgagaccccttcccaaaccctacatatgcaggagctttagtgcatcaggttgccctt 22187421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 472 - 620
Target Start/End: Complemental strand, 19143102 - 19142956
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaa 571  Q
    ||||||| ||||||||| ||||| | ||| | |||| |||||| || || ||||| ||||||||||||||| ||||||||| ||||||||| ||||| ||    
T  19143102 tggtaaaattgttgtcacgtgac-taaaatgccacaggttcaagtcctggaaacaacctcttgtgtaaaaa-cagggtaaggctgcgtacagtacaccaa 19143005  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    |||||||||||| ||| | | || | |||||||||||| ||||||||||    
T  19143004 atggtgggaccccttcccggaccatgcgtatgcgggagatttagtgcac 19142956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 522 - 632
Target Start/End: Complemental strand, 7097870 - 7097761
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||||||||||||||| |||||||||  |||||||||||||| |||||||| ||||| ||| |   || | ||||||||||||||||||||||||    
T  7097870 aaacagcctcttgtgtaaaaa-cagggtaaggttgcgtacaatacaccaaatggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 7097772  T
Q  622 aggttgccctt 632  Q
    | | |||||||    
T  7097771 atgctgccctt 7097761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 525 - 632
Target Start/End: Complemental strand, 13801877 - 13801768
Alignment:
Q  525 cagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacca 622  Q
    |||||||||||||||||||||||||||| ||||||||||||||| |  ||||||||||||| ||| | | ||   | |||||| |||||||||||||||     
T  13801877 cagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccg 13801778  T
Q  623 ggttgccctt 632  Q
    ||||||||||    
T  13801777 ggttgccctt 13801768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 473 - 610
Target Start/End: Original strand, 2838754 - 2838890
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    ||||||||||||||||||||||   ||||||||| || |||| ||    ||||||| |||||||||||| |||||||||| ||||||||||||||| |||    
T  2838754 ggtaaagttgttgtcatgtgactgtaaaggtcacgaggtcaagtctcagaaacagcatcttgtgtaaaa-acagggtaaggctgcgtacaatacaccaaa 2838852  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagc 610  Q
    |||||||| || ||| | | || | |||||||||||||    
T  2838853 tggtgggatcccttctcggaccctgcgtatgcgggagc 2838890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 444 - 613
Target Start/End: Original strand, 22600401 - 22600569
Alignment:
Q  444 tttgtttgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa 543  Q
    |||| |||||||| ||||||||| || |||||||||||||| ||||||||| || ||||| ||  |||||| || || |||||   | |||||||||| |    
T  22600401 tttgcttgaggggtaaccttgacgtaactggtaaagttgttatcatgtgac-tggaaggttacgggttcaagtcctggaaacaatattttgtgtaaaaca 22600499  T
Q  544 cagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagcttt 613  Q
    ||||||||| ||| ||||||||||| ||||||||||| || ||| | |  | | ||||||||||||||||    
T  22600500 cagggtaaggctgtgtacaatacaccaaatggtgggatcccttcccggatcctgcgtatgcgggagcttt 22600569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 471 - 563
Target Start/End: Complemental strand, 37024715 - 37024626
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaa 563  Q
    |||||||||||||||||||||||| |||||||||||  |||||| || || ||||||||||||||||  ||||||||||||| ||||||||||    
T  37024715 ctggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaa 37024626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 477 - 633
Target Start/End: Complemental strand, 12006485 - 12006328
Alignment:
Q  477 aagttgttgtcatgtgacatgaaaggtcacaag-ttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaa--at 573  Q
    |||||||||||||||||| |||||||||||  | ||||| || || ||||| |||||| ||||||||| |||||||| || | |||||||||| ||  ||    
T  12006485 aagttgttgtcatgtgac-tgaaaggtcacggggttcaagtc-tggaaacaacctcttatgtaaaaaatagggtaaggctccatacaatacaccaataat 12006388  T
Q  574 ggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctta 633  Q
    |||||||||| ||| ||| || | | ||||||||||||||||||||||  ||||||||||    
T  12006387 ggtgggaccccttcccagaccctgcctatgcgggagctttagtgcaccgtgttgccctta 12006328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 529 - 621
Target Start/End: Original strand, 43574637 - 43574729
Alignment:
Q  529 ctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    |||||||||| ||||||||||||| |||||||||||| || |||||||||||||| ||| | | || | |||||||||||||||||| |||||    
T  43574637 ctcttgtgtagaaaacagggtaaggctgcgtacaatataccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagagcacc 43574729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 473 - 583
Target Start/End: Complemental strand, 209086 - 208977
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaa 571  Q
    |||||||||||||||||||||| | ||||||||||||||||| || ||  |||| ||||||||||| ||||||||||||| |||| | ||||||| | ||    
T  209086 ggtaaagttgttgtcatgtgac-taaaaggtcacaagttcaagtcctggcaacaacctcttgtgta-aaaacagggtaaggctgcattcaatacaccaaa 208989  T
Q  572 atggtgggaccc 583  Q
    ||||||||||||    
T  208988 atggtgggaccc 208977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 522 - 632
Target Start/End: Original strand, 29334419 - 29334530
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta-aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    |||||||||||||||||||||||| |||||| ||||||||||||||| | ||||||||||||| ||| | | || | |||||| |||| ||||| |||||    
T  29334419 aaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccagaatggtgggacccattcccggaccctgcgtatgtgggatctttaatgcac 29334518  T
Q  621 caggttgccctt 632  Q
    | || |||||||    
T  29334519 cgggctgccctt 29334530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 522 - 630
Target Start/End: Original strand, 7368422 - 7368528
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||||||||||||||  ||||||||| ||||||||||||||| || ||||||||||| ||| | | || | | |||| ||||||| |||||||||    
T  7368422 aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaattggtgggaccccttcccggaccctgcatatgtgggagctctagtgcacc 7368519  T
Q  622 aggttgccc 630  Q
     ||||||||    
T  7368520 gggttgccc 7368528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 522 - 632
Target Start/End: Original strand, 20135628 - 20135740
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca 619  Q
    |||||||||||||||||||||||| |||||| ||||||||||||||| |  ||||||||||||| ||| | | ||   | ||||| ||||||| ||||||    
T  20135628 aaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcagtgca 20135727  T
Q  620 ccaggttgccctt 632  Q
    || ||||||||||    
T  20135728 ccgggttgccctt 20135740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 1565405 - 1565565
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgt-aaaaaacagggtaagactgcgtacaatacact 569  Q
    |||||||||||||||||||||||| ||||||||| |  |||||| || || ||||| ||||||| || ||||||||   |||| ||||||||||| |||     
T  1565405 ctggtaaagttgttgtcatgtgac-tgaaaggtcgcgggttcaagtcctggaaacaacctcttgagtaaaaaaacatattaaggctgcgtacaatgcacc 1565503  T
Q  570 aaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||| ||||||| ||| | | || | | |||| |||||| |||||||||| ||||||||||    
T  1565504 aaatggcgggaccccttcccggaccctgcatatgtgggagc-ttagtgcaccgggttgccctt 1565565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 558 - 632
Target Start/End: Original strand, 16957374 - 16957448
Alignment:
Q  558 gtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||| |||||||||||||| ||| | | || | |||||||||||||||||||||||| ||||||||||    
T  16957374 gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 16957448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 477 - 575
Target Start/End: Complemental strand, 34074717 - 34074620
Alignment:
Q  477 aagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatgg 575  Q
    ||||||||||||  |||| ||||||||||||||||||| || |  ||||||||||||||||||||||||  |||||  ||||| |||||||| ||||||    
T  34074717 aagttgttgtcacatgac-tgaaaggtcacaagttcaagtcctagaaacagcctcttgtgtaaaaaacacagtaaggttgcgttcaatacaccaaatgg 34074620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 473 - 558
Target Start/End: Original strand, 23974756 - 23974840
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcg 558  Q
    |||||||||||||||||||||| || ||||||||  |||||| || || ||||| |||||||||||||||| |||||||| |||||    
T  23974756 ggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaagagggtaaggctgcg 23974840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 544 - 632
Target Start/End: Complemental strand, 34154903 - 34154815
Alignment:
Q  544 cagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||| ||||||||||||||| |||||||||||||| ||| | | || | | ||||||| |||| ||||||||| ||||||||||    
T  34154903 cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgccctt 34154815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 496 - 568
Target Start/End: Complemental strand, 42924971 - 42924899
Alignment:
Q  496 tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    ||||||||||| ||||||| || || ||||| | |||||||||||||||||||||||  ||||||||||||||    
T  42924971 tgaaaggtcacgagttcaagtcctgaaaacaacatcttgtgtaaaaaacagggtaaggttgcgtacaatacac 42924899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 480 - 587
Target Start/End: Original strand, 1405170 - 1405276
Alignment:
Q  480 ttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtggg 579  Q
    |||||||||||||||  ||| ||||||  |||||| || || ||||| |||||| | ||||||| || |||||  |||||||||||||| ||||||||||    
T  1405170 ttgttgtcatgtgactagaa-ggtcacgggttcaagtcctggaaacaacctcttatataaaaaatagagtaagtttgcgtacaatacaccaaatggtggg 1405268  T
Q  580 accctttc 587  Q
    ||||||||    
T  1405269 accctttc 1405276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 474 - 632
Target Start/End: Complemental strand, 31694266 - 31694109
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaat 573  Q
    ||||||||||||||| ||||| ||| |||||| | |||||| || || ||| || | || |||||||||| ||| |||  |||| ||||||||||  | |    
T  31694266 gtaaagttgttgtcacgtgac-tgataggtcataggttcaagtcttgaaaaaagtcactcgtgtaaaaaataggctaaagctgcatacaatacacctatt 31694168  T
Q  574 ggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    | |||||| | ||| ||| |||| |||||||||||| |||||||||||||  |||||||    
T  31694167 gatgggactccttcccagaccttgcgtatgcgggagatttagtgcaccagactgccctt 31694109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 473 - 621
Target Start/End: Original strand, 39301099 - 39301246
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaa 571  Q
    ||||||||||||||||||| || |||||||||||  |||||| || ||  |||| ||||||||||| |||||||||||||  |||||| ||| || | ||    
T  39301099 ggtaaagttgttgtcatgttac-tgaaaggtcacgggttcaagtcttgggaacaacctcttgtgtataaaacagggtaaggatgcgtataatgcaccaaa 39301197  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    | |||||||||| ||| | | || | |||||| ||||| |||||||||||    
T  39301198 aaggtgggaccccttcccggaccctccgtatgtgggag-tttagtgcacc 39301246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 471 - 567
Target Start/End: Original strand, 31299606 - 31299700
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca 567  Q
    |||||||||||||||||||||||| | | ||||||| ||||||| || |  |||||||||||||| |  ||||||| |||| |||||||||||||||    
T  31299606 ctggtaaagttgttgtcatgtgac-ttacaggtcactagttcaagtcctagaaacagcctcttgtat-taaaacagtgtaaaactgcgtacaataca 31299700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 573 - 629
Target Start/End: Original strand, 39801591 - 39801647
Alignment:
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcc 629  Q
    ||||||||||| ||| ||| || |||||||||||||||||||||||||| |||||||    
T  39801591 tggtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgcc 39801647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 523 - 582
Target Start/End: Original strand, 36770806 - 36770864
Alignment:
Q  523 aacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggacc 582  Q
    ||||||||||| ||||||||||| |||||| | || ||||||||||||||||||||||||    
T  36770806 aacagcctcttatgtaaaaaacaaggtaagcc-gcatacaatacactaaatggtgggacc 36770864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 532 - 583
Target Start/End: Original strand, 41425982 - 41426033
Alignment:
Q  532 ttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc 583  Q
    ||||||||||||||||||||| |||| |||||||||| || |||||||||||    
T  41425982 ttgtgtaaaaaacagggtaaggctgcatacaatacaccaattggtgggaccc 41426033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 475 - 613
Target Start/End: Complemental strand, 24323862 - 24323725
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatg 574  Q
    |||||||||| || |||||| ||||| |||| | |||||| |  || ||||| |||||||||||||| ||||||||||  |||||| ||||| | ||||     
T  24323862 taaagttgttatcgtgtgac-tgaaatgtcaaatgttcaagttctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaata 24323764  T
Q  575 gtgggaccctttcgcagcccttacgtatgcgggagcttt 613  Q
    ||||||||| ||| ||| || |   ||||||||||||||    
T  24323763 gtgggaccccttcccagaccctgtatatgcgggagcttt 24323725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 475 - 613
Target Start/End: Complemental strand, 24360486 - 24360349
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatg 574  Q
    |||||||||| || |||||| ||||| |||| | |||||| |  || ||||| |||||||||||||| ||||||||||  |||||| ||||| | ||||     
T  24360486 taaagttgttatcgtgtgac-tgaaatgtcaaatgttcaagttctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaata 24360388  T
Q  575 gtgggaccctttcgcagcccttacgtatgcgggagcttt 613  Q
    ||||||||| ||| ||| || |   ||||||||||||||    
T  24360387 gtgggaccccttcccagaccctgtatatgcgggagcttt 24360349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 522 - 583
Target Start/End: Complemental strand, 22907975 - 22907915
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc 583  Q
    ||||||||||||||||||||| ||| |||||  ||| |||||||||| ||||||||||||||    
T  22907975 aaacagcctcttgtgtaaaaa-cagagtaaggttgcatacaatacaccaaatggtgggaccc 22907915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 598 - 639
Target Start/End: Complemental strand, 29184096 - 29184055
Alignment:
Q  598 cgtatgcgggagctttagtgcaccaggttgcccttattgttt 639  Q
    |||||||||||||||||||||||| |||||||||||| ||||    
T  29184096 cgtatgcgggagctttagtgcaccgggttgcccttatagttt 29184055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 496 - 552
Target Start/End: Original strand, 22025541 - 22025597
Alignment:
Q  496 tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaag 552  Q
    ||||||||||   |||||| || || |||||||||||||||||||||||||||||||    
T  22025541 tgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaag 22025597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 600 - 634
Target Start/End: Original strand, 19438768 - 19438802
Alignment:
Q  600 tatgcgggagctttagtgcaccaggttgcccttat 634  Q
    |||||||||||| ||||||||||||||||||||||    
T  19438768 tatgcgggagctctagtgcaccaggttgcccttat 19438802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 481 - 582
Target Start/End: Original strand, 1850624 - 1850723
Alignment:
Q  481 tgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtggga 580  Q
    |||||||||||||| |||||||||||  |||||| ||  | ||| | ||||||||||||||| |||  ||||  |||||||||||||  |||||||||||    
T  1850624 tgttgtcatgtgac-tgaaaggtcacgggttcaagtcccggaaataacctcttgtgtaaaaa-cagaataagggtgcgtacaatacatcaaatggtggga 1850721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 540 - 621
Target Start/End: Complemental strand, 9794471 - 9794390
Alignment:
Q  540 aaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    |||||||||||||||||| |||||||||| |||| |||||| || ||| ||| ||   | ||||| | ||||||||||||||    
T  9794471 aaaacagggtaagactgcatacaatacaccaaatagtgggatcccttcacagacccagcatatgcagaagctttagtgcacc 9794390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 522 - 583
Target Start/End: Complemental strand, 24903807 - 24903746
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccc 583  Q
    ||||||||| |||||||||||| ||||||||| || ||||||| ||| || ||||| |||||    
T  24903807 aaacagccttttgtgtaaaaaatagggtaagattgtgtacaatccaccaattggtgagaccc 24903746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 571 - 632
Target Start/End: Original strand, 25622533 - 25622594
Alignment:
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || | |||||||||||||||||||||||| | ||||||||    
T  25622533 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccctt 25622594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 599 - 632
Target Start/End: Original strand, 32354228 - 32354261
Alignment:
Q  599 gtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||||||||||||| ||||||||||    
T  32354228 gtatgcgggagctttagtgcaccgggttgccctt 32354261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 86; Significance: 2e-40; HSPs: 74)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 86; E-Value: 2e-40
Query Start/End: Original strand, 449 - 634
Target Start/End: Complemental strand, 6430808 - 6430625
Alignment:
Q  449 ttgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacaggg 548  Q
    |||||||| ||||||| |  | |||||||||||||||||||||||| |||||||||||  |||||| || || ||||||||||||||||||||| |||||    
T  6430808 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcatggaaacagcctcttgtgtaaaaa-caggg 6430711  T
Q  549 taagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcccttat 634  Q
    |||| ||||||||||||||| |||||||||||||  ||| | | || | |||||||||||||||||| ||||| ||||||||||||    
T  6430710 taaggctgcgtacaatacaccaaatggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggttgcccttat 6430625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 450 - 632
Target Start/End: Original strand, 5648212 - 5648392
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||||||| |  | |||||||||||||||||||||||| || ||||||||  |||||| || || |||||||||||||||||||| |||||||    
T  5648212 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-tgtaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-acagggt 5648309  T
Q  550 aagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||| ||||||||||||||| |||||||||||||| ||| | | || | ||||||||||||||| |||||||  ||||||||||    
T  5648310 aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgccctt 5648392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 77; E-Value: 4e-35
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 16408764 - 16408602
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  |||||| || || ||||||||||||||||||||||||||||||||||||||||||||||| |    
T  16408764 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacca 16408666  T
Q  571 --aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
      |||||||| |||| ||| | | ||   | |||||||||||||||||||||| ||||||||||    
T  16408665 ataatggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctt 16408602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 77; E-Value: 4e-35
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 44363293 - 44363131
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac-- 568  Q
    |||||||||||||||||||||||| ||||||||||| ||||||| || || |||||||||| |||||||||||||||||| | ||||||||||  |||      
T  44363293 ctggtaaagttgttgtcatgtgac-tgaaaggtcacgagttcaagtcctgaaaacagcctcgtgtgtaaaaaacagggtagggctgcgtacaacgcacca 44363195  T
Q  569 taaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
     |||||||||||||| ||| | | || | |||||||||||||||||||||||| ||||||||||    
T  44363194 aaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 44363131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 450 - 632
Target Start/End: Complemental strand, 48599005 - 48598826
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||||||| |  | |||||||||||||||||||||||| |||||||||||  |||||| || || ||||||||||||||||||||  ||||||    
T  48599005 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggt 48598909  T
Q  550 aagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||| ||||||||||||||| |||||||||||||| ||| | | || | | ||||| |||||| ||||||||| ||||||||||    
T  48598908 aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccgggttgccctt 48598826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 75; E-Value: 6e-34
Query Start/End: Original strand, 471 - 630
Target Start/End: Original strand, 21646938 - 21647098
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||| |||||| || || |||||||||||||||||||||| |||||||| |||||||||||| || |    
T  21646938 ctggtaaagttgttgtcatgtgac-tggaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaaggctgcgtacaatatacca 21647036  T
Q  571 --aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccc 630  Q
      ||||||||||||| ||| ||| ||   | |||||||||||||||||||||| ||||||||    
T  21647037 ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc 21647098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 75; E-Value: 6e-34
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 47528689 - 47528531
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |||||||||||| |||||| || || ||||||||||||||||||||  ||||||||| ||||||||||||||| |    
T  47528689 ctggtaaagttgttgtcatgtgac-tgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacca 47528593  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || |   |||| ||||||| ||||||||| ||||||||||    
T  47528592 aatggtgggaccccttcccggaccctgaatatgtgggagctctagtgcaccgggttgccctt 47528531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 477 - 630
Target Start/End: Complemental strand, 17043549 - 17043398
Alignment:
Q  477 aagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggt 576  Q
    |||||||||||| ||||| |||||||||||| |||||| || || |||||||||||||||||||| |||||||||| ||||||||||||||| |||||||    
T  17043549 aagttgttgtcaagtgac-tgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatggt 17043451  T
Q  577 gggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccc 630  Q
    ||||||| ||| ||| || | | ||||| ||||||||| ||||||||| |||||    
T  17043450 gggaccccttcccagaccctgcatatgctggagcttta-tgcaccaggctgccc 17043398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 448 - 632
Target Start/End: Original strand, 20224935 - 20225116
Alignment:
Q  448 tttgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagg 547  Q
    ||||||||| ||||||| |  | |||||||||||||||||||||||| ||||||||||   |||||| || || ||||| ||||||||||||||  ||||    
T  20224935 tttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-tgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaa--cagg 20225031  T
Q  548 gtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||| ||||||||||||||| |||||||||||||| ||| | | || | | |||||||||||| ||||||||| ||||||||||    
T  20225032 gtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 20225116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 11054307 - 11054149
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |||||||||||  |||||| || || |||||| |||||||||||||  ||||||||||||||||||||||||| |    
T  11054307 ctggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctgaaaacagtctcttgtgtaaaa--cagggtaagactgcgtacaatacacca 11054211  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||| || |||| ||| | | || | | |||||||||||| ||||||||| ||||||||||    
T  11054210 aatggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 11054149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 450 - 632
Target Start/End: Original strand, 30639333 - 30639513
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||||||| |  | ||||||||||||||||| |||||| |||||||||||  |||||| || || |||||| ||||||||||||| |||||||    
T  30639333 tgaggggtaaccttggcgcaactggtaaagttgttgtcttgtgac-tgaaaggtcactggttcaagtcctggaaacagactcttgtgtaaaa-acagggt 30639430  T
Q  550 aagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||| ||||||||||||||| |||||||| ||||| ||| | | || | | |||||||||||||||||||||  ||||||||||    
T  30639431 aaggctgcgtacaatacaccaaatggtgagaccccttcccggaccctgcatatgcgggagctttagtgcactgggttgccctt 30639513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 471 - 635
Target Start/End: Original strand, 40915803 - 40915965
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |  ||||||||  |||||| || || ||||||||||||||||||||| || |||||| ||||||||||||||| |    
T  40915803 ctggtaaagttgttgtcatgtgac-tataaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-caaggtaaggctgcgtacaatacacca 40915900  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcccttatt 635  Q
    |||||||||| || ||| | | || | ||||||||||||||| |||||||| | |||||||||||    
T  40915901 aatggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgcaccggattgcccttatt 40915965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 68; E-Value: 8e-30
Query Start/End: Original strand, 522 - 632
Target Start/End: Complemental strand, 20639770 - 20639659
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    ||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||| ||| | | || | |||||||||||||||||||||||    
T  20639770 aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac 20639671  T
Q  621 caggttgccctt 632  Q
    | ||||||||||    
T  20639670 cgggttgccctt 20639659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 458 - 632
Target Start/End: Original strand, 14983795 - 14983968
Alignment:
Q  458 aaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgc 557  Q
    ||||||| || | ||||||||||||||||||| |||  || ||||||||   ||||| || |  |||||||||||||||||||||| ||||||||  |||    
T  14983795 aaccttggcagaactggtaaagttgttgtcatatgat-tggaaggtcacggattcaagtctttgaaacagcctcttgtgtaaaaaatagggtaaggttgc 14983893  T
Q  558 gtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
     ||||||||||||||||||||||||| ||| | | || | |||||||||||||||||||| |||| |||||||||    
T  14983894 ctacaatacactaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctt 14983968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 23501767 - 23501923
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |||||||||||  |||||| ||      |||||||||||||||||||||||||||||  |||||||||||||| |    
T  23501767 ctggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtc------acagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacacca 23501859  T
Q  571 --aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
      ||||||||||||| ||| | | || | | |||||||||||||||||||||| ||||||||||    
T  23501860 ataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt 23501923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 473 - 632
Target Start/End: Original strand, 35567146 - 35567304
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    ||||||||||||||||||| || ||||||||||   |||||| || || |||||||| |||||||||||||||||||||| ||| |||||| |||| |||    
T  35567146 ggtaaagttgttgtcatgtaac-tgaaaggtcatgggttcaagtcttggaaacagccacttgtgtaaaaaacagggtaaggctgtgtacaacacaccaaa 35567244  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||| ||| |   || | ||| |||||||||||||||||||| || |||||||    
T  35567245 tggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgcaccgggctgccctt 35567304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 522 - 632
Target Start/End: Original strand, 25629073 - 25629183
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    |||||| ||||||||||||||| |||||||| ||| ||||||||||| |||||||||||||| ||| | | || ||| ||||||||||||||||||||||    
T  25629073 aaacagtctcttgtgtaaaaaatagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctacatatgcgggagctttagtgcacc 25629172  T
Q  622 aggttgccctt 632  Q
     ||||||||||    
T  25629173 gggttgccctt 25629183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 62; E-Value: 3e-26
Query Start/End: Original strand, 450 - 632
Target Start/End: Complemental strand, 5306845 - 5306661
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||||||| |  | |||||||||||| ||||||||||| |||||||||||  |||||| || || ||||||||||||||||||||  ||||||    
T  5306845 tgaggggtaaccttggcgcaactggtaaagttgatgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaat-cagggt 5306748  T
Q  550 aagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatg----cgggagctttagtgcaccaggttgccctt 632  Q
    |||  |||||||||||||| |||||||||||||| ||| | | || | ||||||    ||||||||||| |||||| ||||||||||    
T  5306747 aaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgtggacgggagctttaatgcaccgggttgccctt 5306661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 62; E-Value: 3e-26
Query Start/End: Original strand, 472 - 621
Target Start/End: Original strand, 19027823 - 19027971
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaa 571  Q
    ||||| ||||||||||| ||||| |||||||||||  |||||| || || ||||| | ||||||||||||||||||||||| ||||||||||||||| ||    
T  19027823 tggtagagttgttgtcacgtgac-tgaaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaa 19027921  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
     ||||||||||| ||  ||| |  | |||||| |||||||||||||||||    
T  19027922 ttggtgggacccctttccagactctgcgtatgtgggagctttagtgcacc 19027971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 62; E-Value: 3e-26
Query Start/End: Original strand, 472 - 632
Target Start/End: Original strand, 47443928 - 47444091
Alignment:
Q  472 tggtaaagttgttgtcatgtgacat---gaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    ||||||||||||| |||||||||     ||||||||||  |||||| || || ||||||||||||| ||||||||||||||||| |||||||||||||||    
T  47443928 tggtaaagttgttctcatgtgaccgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtacaatacac 47444027  T
Q  569 taaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
     |||||||||||||| ||| | | || | | ||||| ||||||| |||||||  ||||||||||    
T  47444028 caaatggtgggaccccttcccggaccctgcatatgcaggagcttcagtgcactgggttgccctt 47444091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 16911536 - 16911698
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| | |||||||||  |||||| || |  ||||||||||||||||| ||| ||||||||| ||||||||||||||| |    
T  16911536 ctggtaaagttgttgtcatgtgactt-aaaggtcacgggttcaagtcctagaaacagcctcttgtgtacaaatcagggtaaggctgcgtacaatacacca 16911634  T
Q  571 --aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
      ||||||||||||| ||| | | || | |||| ||||||||||||||  ||| ||||||||||    
T  16911635 ataatggtgggaccccttcccggaccctgcgtacgcgggagctttagtttaccgggttgccctt 16911698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 519 - 621
Target Start/End: Complemental strand, 51865152 - 51865050
Alignment:
Q  519 tgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgc 618  Q
    ||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||||||| ||| ||| | | || | ||||||||||||||||| |||    
T  51865152 tgtaaacagcctcttgtgtaaaaaacatggtaaggctgcgtacaatacaccaaatggtggggccccttcccggaccctgcgtatgcgggagctttattgc 51865053  T
Q  619 acc 621  Q
    |||    
T  51865052 acc 51865050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 58; E-Value: 8e-24
Query Start/End: Original strand, 471 - 619
Target Start/End: Original strand, 37494825 - 37494972
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    ||||||||||||||| |||| ||| |||||||||||| |||||| || || ||||| |||||||||||||||||||||||||  ||| ||||||| || |    
T  37494825 ctggtaaagttgttgccatgcgac-tgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggttgcatacaatatacca 37494923  T
Q  571 aatggtgggaccc-tttcgcagcccttacgtatgcgggagctttagtgca 619  Q
    ||||||||||||| |||||   ||||  ||||||| ||||||||||||||    
T  37494924 aatggtgggacccctttcgggaccctg-cgtatgcaggagctttagtgca 37494972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 475 - 632
Target Start/End: Complemental strand, 9832468 - 9832314
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatg 574  Q
    |||| ||||||| || |||| |||||||||||  |||||| || || ||||||||||||||||||||  ||||||||| ||||||||||||||| |||||    
T  9832468 taaaattgttgtgatctgac-tgaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatg 9832372  T
Q  575 gtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||| ||| | | || | | ||||| ||| || ||||||||| ||||||||||    
T  9832371 gtgggaccccttcccggaccctgcatatgcaggaactctagtgcaccgggttgccctt 9832314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 475 - 632
Target Start/End: Complemental strand, 30690340 - 30690177
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-------cagggtaagactgcgtacaataca 567  Q
    |||||| ||||||| ||||| |||||||||||  |||||| || || ||| ||||||||||||||||||       ||||||||| |||| |||||||||    
T  30690340 taaagtggttgtcaagtgac-tgaaaggtcacgggttcaagtcctggaaaaagcctcttgtgtaaaaaataaaaaacagggtaaggctgcatacaataca 30690242  T
Q  568 ctaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    | || ||||||||||| ||| | | || | ||||||||||||||||||||||||||| |||||||    
T  30690241 ccaattggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgccctt 30690177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 473 - 630
Target Start/End: Original strand, 54966997 - 54967151
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||||||||||||| |||||||||||| |||||| |  || ||| | |||||||||||||||||||||||||  ||| ||||||| || |||    
T  54966997 ggtaaagttgttgtcatgtgac-tgaaaggtcacatgttcaagttctggaaagaacctcttgtgtaaaaaacagggtaaggttgc-tacaatataccaaa 54967094  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccc 630  Q
    ||||||||||| ||| |   || ||| |||||||||||||| ||||||| || |||||    
T  54967095 tggtgggaccccttcccgtaccctacatatgcgggagcttt-gtgcaccgggctgccc 54967151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 473 - 580
Target Start/End: Complemental strand, 487294 - 487187
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacact-aa 571  Q
    |||||||||||||||||||||| |||||||||||  |||||| || || ||||| ||||||||||| |||||| |||||  |||||||||||||||| ||    
T  487294 ggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaaacaaggtaaagctgcgtacaatacactaaa 487196  T
Q  572 atggtggga 580  Q
    |||||||||    
T  487195 atggtggga 487187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 496 - 631
Target Start/End: Complemental strand, 29208033 - 29207900
Alignment:
Q  496 tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct 595  Q
    |||||||||||  |||||| || || |||  |||||||||||||||  ||||||||| ||||||||||||||| |||||||||||||| ||| | | ||     
T  29208033 tgaaaggtcacgggttcaagtcctggaaattgcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc 29207936  T
Q  596 tacgtatgcgggagctttagtgcaccaggttgccct 631  Q
    | | |||||||||||| ||||||||| |||||||||    
T  29207935 tgcatatgcgggagctctagtgcaccgggttgccct 29207900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 473 - 582
Target Start/End: Complemental strand, 39029220 - 39029111
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac-taa 571  Q
    ||||||||||||||| |||||| | |||||||| | ||||||  | || ||||||||||||||||||||||||||||||| ||| |||||||||||  ||    
T  39029220 ggtaaagttgttgtcgtgtgac-taaaaggtcataggttcaagccttggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacgaaa 39029122  T
Q  572 atggtgggacc 582  Q
    |||||||||||    
T  39029121 atggtgggacc 39029111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 451 - 632
Target Start/End: Complemental strand, 55830902 - 55830722
Alignment:
Q  451 gaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcaca-agttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    |||||| |||||||||  | |||||||||||||||||||||||   ||| ||||||  ||||||| |  || |||||| |||||||||  ||| ||||||    
T  55830902 gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgatcggaa-ggtcacggagttcaagttttggaaacagtctcttgtgtgtaaa-cagggt 55830805  T
Q  550 aagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||  |||||||||||||||| |||||||| ||||  || | | |||| |||||||| |||||||||||||||||| |||||||    
T  55830804 aatgctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccaggatgccctt 55830722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 483 - 624
Target Start/End: Original strand, 25463108 - 25463247
Alignment:
Q  483 ttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggacc 582  Q
    |||||||||||| |||||||||||  |||||| || || ||||| ||||||||||||||||| ||| |||  ||||||||| |||| |||||||||||||    
T  25463108 ttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaactgggaaaggttgcgtacaacacaccaaatggtgggacc 25463206  T
Q  583 ctttcgcagcccttacgtatgcgggagctttagtgcaccagg 624  Q
    | ||| | | || | | |||||||||||||| ||||||||||    
T  25463207 ccttcccggaccctgcatatgcgggagcttt-gtgcaccagg 25463247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 471 - 582
Target Start/End: Original strand, 14590811 - 14590922
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaa-aacagggtaagactgcgtacaatacact 569  Q
    |||||||||||||||||||||||| |||||||||||   ||||| || |  |||||||||||||| ||||| ||||||||||| |||| |||||||||      
T  14590811 ctggtaaagttgttgtcatgtgac-tgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacagggtaaggctgcatacaatacatc 14590909  T
Q  570 aaatggtgggacc 582  Q
    |||||||||||||    
T  14590910 aaatggtgggacc 14590922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 473 - 632
Target Start/End: Complemental strand, 20908797 - 20908637
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaa 571  Q
    ||||||||||||||||||||||   ||| || ||| |||||| || || ||||| | |||| | ||||||| | |||||| |||||||||||||| | ||    
T  20908797 ggtaaagttgttgtcatgtgactgaaaatgttacatgttcaagtcatggaaacatcgtcttttctaaaaaagaaggtaaggctgcgtacaatacaccaaa 20908698  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||| ||| |   || | ||||||||||||||||||||||| ||| |||||||    
T  20908697 atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacaaggctgccctt 20908637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 472 - 568
Target Start/End: Original strand, 25343162 - 25343257
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    ||||||||||||||||| ||||| ||| |||||||| |||||| |  || ||| || |||||||||||||||||||||||| |||||||||||||||    
T  25343162 tggtaaagttgttgtcacgtgac-tgataggtcacaggttcaagttctggaaatagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacac 25343257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 480 - 587
Target Start/End: Complemental strand, 7385628 - 7385522
Alignment:
Q  480 ttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtggg 579  Q
    ||||||||||||||| |||||||||||  ||||||  | || |||||||||| ||||||||||| ||||||||  || || |||||||| ||||||||||    
T  7385628 ttgttgtcatgtgac-tgaaaggtcacgggttcaagccctggaaacagcctcatgtgtaaaaaatagggtaaggttgtgtgcaatacaccaaatggtggg 7385530  T
Q  580 accctttc 587  Q
    ||||||||    
T  7385529 accctttc 7385522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 471 - 630
Target Start/End: Original strand, 10660378 - 10660538
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |||||||| ||| |||||| || || ||||| |||||| ||||||||| |||||| | |||| |||||||||| |    
T  10660378 ctggtaaagttgttgtcatgtgac-tgaaaggttacatgttcaagtcctggaaacaacctcttatgtaaaaaatagggtatggctgcatacaatacacca 10660476  T
Q  571 --aatggtgggaccctttcgcagcccttacgtatgcgggagcttt-agtgcaccaggttgccc 630  Q
      ||||||| ||||| |||  || || | |||||||||||||||| |||||| | ||||||||    
T  10660477 ataatggtgagaccccttccaagacc-tgcgtatgcgggagctttaagtgcatcgggttgccc 10660538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 471 - 630
Target Start/End: Original strand, 10874523 - 10874683
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |||||||| ||| |||||| || || ||||| |||||| ||||||||| |||||| | |||| |||||||||| |    
T  10874523 ctggtaaagttgttgtcatgtgac-tgaaaggttacatgttcaagtcctggaaacaacctcttatgtaaaaaatagggtatggctgcatacaatacacca 10874621  T
Q  571 --aatggtgggaccctttcgcagcccttacgtatgcgggagcttt-agtgcaccaggttgccc 630  Q
      ||||||| ||||| |||  || || | |||||||||||||||| |||||| | ||||||||    
T  10874622 ataatggtgagaccccttccaagacc-tgcgtatgcgggagctttaagtgcatcgggttgccc 10874683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 530 - 632
Target Start/End: Complemental strand, 12711553 - 12711450
Alignment:
Q  530 tcttgtgtaaaaaac-agggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgc 628  Q
    ||||||||||||||  |||||||||||||||||||||||| |||||| ||||||| ||| ||| |||  ||||||||| | ||||||||||||  |||||    
T  12711553 tcttgtgtaaaaaaatagggtaagactgcgtacaatacaccaaatggcgggaccccttctcagacctagcgtatgcggaaactttagtgcacccagttgc 12711454  T
Q  629 cctt 632  Q
    ||||    
T  12711453 cctt 12711450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 13256558 - 13256400
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||| | |||||| || || |    |||||||||||||||||||||||||| ||||||||||||||| |    
T  13256558 ctggtaaagttgttgtcatgtgac-tggaaggtcataggttcaagtcctgga----gcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca 13256464  T
Q  571 --aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
      ||| ||||||||| ||| |   ||   | | |||||||||||||||||||| ||||||||||    
T  13256463 ataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggttgccctt 13256400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 471 - 633
Target Start/End: Complemental strand, 8473781 - 8473620
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    ||||||||||||||||||| ||||  ||| |||  |  |||||| || || ||||||||||||||||  ||  ||||||||| |||| |||||||||| |    
T  8473781 ctggtaaagttgttgtcatatgaccggaa-ggttgcgggttcaagtcctggaaacagcctcttgtgtttaa--cagggtaaggctgcatacaatacacca 8473685  T
Q  571 aatggtgggaccctttcgcag--cccttacgtatgcgggagctttagtgcaccaggttgccctta 633  Q
    ||||||||||||| ||| | |  ||| | | |||||||||||||||||||||| |||||||||||    
T  8473684 aatggtgggaccccttccccggacccctgcatatgcgggagctttagtgcaccgggttgccctta 8473620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 522 - 632
Target Start/End: Original strand, 20405110 - 20405223
Alignment:
Q  522 aaacagcctcttgtgtaaaa-aacagggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgc 618  Q
    |||||||||||||||||||| |||||||||||| ||||||||||||||||  ||||||||||||| ||| | | ||   | |||||||||||||||||||    
T  20405110 aaacagcctcttgtgtaaaaaaacagggtaagattgcgtacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgc 20405209  T
Q  619 accaggttgccctt 632  Q
    |   ||||||||||    
T  20405210 attgggttgccctt 20405223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 473 - 583
Target Start/End: Complemental strand, 47441689 - 47441580
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||||||| ||||| |||||||||||| |||||| ||    |||||| ||||| |||||||| ||||||||| ||| ||||||||||| |||    
T  47441689 ggtaaagttgttgtcacgtgac-tgaaaggtcacaggttcaagtccaagaaacagtctcttttgtaaaaatcagggtaaggctgtgtacaatacaccaaa 47441591  T
Q  573 tggtgggaccc 583  Q
    |||| ||||||    
T  47441590 tggttggaccc 47441580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 477 - 632
Target Start/End: Original strand, 54175043 - 54175199
Alignment:
Q  477 aagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgt-gtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatg 574  Q
    |||||||||||||||||| ||||| |||||   ||||| || | | |||||||||||||||| |||||||||||||| |||||||||||||| | |||||    
T  54175043 aagttgttgtcatgtgac-tgaaatgtcacggattcaagtcctggaaaacagcctcttgtgt-aaaaacagggtaaggctgcgtacaatacaccaaaatg 54175140  T
Q  575 gtggga-ccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||| ||||| | | | || | | |||||||||||||||||||||| || |||||||    
T  54175141 gtgggaccccttccccggaccctgcatatgcgggagctttagtgcaccgggctgccctt 54175199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 451 - 632
Target Start/End: Complemental strand, 55766647 - 55766467
Alignment:
Q  451 gaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaag-ttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    |||||| |||||||||  | ||||||||||||||||||||||||  ||| ||||||  | ||||| |  || ||||||  ||||||||  ||| ||||||    
T  55766647 gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgaccggaa-ggtcacggggttcaagttttggaaacagtttcttgtgtgtaaa-cagggt 55766550  T
Q  550 aagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||| |||||||||||||||| |||||||| ||||  || | | |||| |||||||| ||||||||||||||| || |||||||    
T  55766549 aaggctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccgggatgccctt 55766467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 522 - 633
Target Start/End: Complemental strand, 7909391 - 7909280
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgc-gggagctttagtgcac 620  Q
    |||||| |||||||||||||| |||||||||  |||||||||||||| |||||||||||||| ||| |   || | ||||||| |||||||||||||||     
T  7909391 aaacagtctcttgtgtaaaaa-cagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcggggagctttagtgcat 7909293  T
Q  621 caggttgccctta 633  Q
    | |||||||||||    
T  7909292 cgggttgccctta 7909280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 522 - 633
Target Start/End: Original strand, 21489111 - 21489223
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    ||||||||||||| ||||||||||| ||||||||||||||||| || | |||||||||||||| ||| |   || | |||||||||||||||| ||||||    
T  21489111 aaacagcctcttgcgtaaaaaacagagtaagactgcgtacaatgcaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttcgtgcac 21489210  T
Q  621 caggttgccctta 633  Q
      |||||| ||||    
T  21489211 tgggttgctctta 21489223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 480 - 620
Target Start/End: Complemental strand, 41018945 - 41018807
Alignment:
Q  480 ttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtggg 579  Q
    ||||||||| ||||| |||||||||||  |||||| || || ||||| ||||||||||||||   |||||||| || |||||||||||| |||| |||||    
T  41018945 ttgttgtcacgtgac-tgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatt-agggtaaggctacgtacaatacaccaaatagtggg 41018848  T
Q  580 accctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    |||| ||| ||| |||| ||||||  || ||||||||||||    
T  41018847 accccttcccagaccttgcgtatggaggggctttagtgcac 41018807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 485 - 568
Target Start/End: Original strand, 7038041 - 7038122
Alignment:
Q  485 gtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    |||||||||| |||||||||||| |||||| || || ||||||| |||||||||||||| ||||||||||| ||||||||||||    
T  7038041 gtcatgtgac-tgaaaggtcacaggttcaagtcctg-aaacagcttcttgtgtaaaaaatagggtaagacttcgtacaatacac 7038122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 522 - 621
Target Start/End: Complemental strand, 9987945 - 9987846
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||| ||||||||||||| || |||||||| |||| |||||||||| |||||||||||||| |||   | |||| | ||||||||||||||| ||||||    
T  9987945 aaacaacctcttgtgtaaacaatagggtaaggctgcatacaatacaccaaatggtgggaccccttccttgaccttgcatatgcgggagctttaatgcacc 9987846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 476 - 615
Target Start/End: Complemental strand, 49938746 - 49938611
Alignment:
Q  476 aaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatg 574  Q
    ||||||||||||| ||||| |||||||||||| |||||| || || ||||||||||||||||| ||||| |||||||   | |||||||||| | |||||    
T  49938746 aaagttgttgtcacgtgac-tgaaaggtcacaggttcaagtcctggaaacagcctcttgtgta-aaaacggggtaag---gtgtacaatacaccaaaatg 49938652  T
Q  575 gtgggaccctttcgcagcccttacgtatgcgggagctttag 615  Q
    ||||||||| ||| ||  || | | ||||||||||||||||    
T  49938651 gtgggaccccttcccataccctgcatatgcgggagctttag 49938611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 530 - 587
Target Start/End: Complemental strand, 17079754 - 17079697
Alignment:
Q  530 tcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttc 587  Q
    ||||||||| ||||||||||||| |||| |||||||| ||||||||||||||||||||    
T  17079754 tcttgtgtataaaacagggtaaggctgcatacaatacgctaaatggtgggaccctttc 17079697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 478 - 629
Target Start/End: Complemental strand, 39077948 - 39077800
Alignment:
Q  478 agttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtg 577  Q
    ||||||||||||||||  |||||||||||  |||||| || || ||||||||||||||||  |||||||||||||  ||||||||||| || ||||||||    
T  39077948 agttgttgtcatgtgat-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaaggttgcgtacaatataccaaatggtg 39077852  T
Q  578 ggac-cctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcc 629  Q
     |||  ||||| | | || | | |||||||||||| ||||||||| |||||||    
T  39077851 agacatctttc-cggaccctgcatatgcgggagctctagtgcaccgggttgcc 39077800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 30352752 - 30352581
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-----cagggtaaga----ctgcgtac 561  Q
    |||||||||||||||||| |||||  ||||||||||  |||  | || || ||||||||||||||||||||||     |||||||||     ||||||||    
T  30352752 ctggtaaagttgttgtcaagtgacc-gaaaggtcacgggttagagtcctggaaacagcctcttgtgtaaaaaaaaaaacagggtaagtaaagctgcgtac 30352654  T
Q  562 aatacactaaa--tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||| |||  ||||||||||| ||| | | || | ||||||||||||||||||||||||  |||||||||    
T  30352653 aatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgccctt 30352581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 473 - 621
Target Start/End: Original strand, 54730225 - 54730375
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgt-aaaaaacagggtaagactgcgtacaatacacta- 570  Q
    ||||||||||||||||||||||   |||||||||  |||||| || |  |||||||||||||||| |||||| ||| |||| ||||||| ||||||| |     
T  54730225 ggtaaagttgttgtcatgtgac-caaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaaataggataaggctgcgtataatacaccaa 54730323  T
Q  571 -aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
     |||| ||| |||| ||| | | || | ||||||||||||||||||||||||    
T  54730324 taatgatggaaccccttcccggaccctgcgtatgcgggagctttagtgcacc 54730375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 476 - 581
Target Start/End: Complemental strand, 30496476 - 30496374
Alignment:
Q  476 aaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatgg 575  Q
    ||||||||||||| ||||| |||||||||||  |||||| || || ||||||||||||||||||| |   ||||||| |||| |||||||||| ||||||    
T  30496476 aaagttgttgtcacgtgac-tgaaaggtcacgtgttcaagtcatggaaacagcctcttgtgtaaaca--cgggtaaggctgcatacaatacaccaaatgg 30496380  T
Q  576 tgggac 581  Q
     |||||    
T  30496379 ggggac 30496374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 522 - 612
Target Start/End: Original strand, 49796822 - 49796911
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctt 612  Q
    |||||||||||||||| |||| || |||||| ||||||||||||||| |||||||||||||| ||| |   || | |||||||||||||||    
T  49796822 aaacagcctcttgtgttaaaa-catggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctt 49796911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 475 - 560
Target Start/End: Complemental strand, 23580365 - 23580281
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgta 560  Q
    |||||||||||||| ||||| |||||||||||  |||||| |  |  ||| ||||||||||||||||||||||| |||||||||||    
T  23580365 taaagttgttgtcacgtgac-tgaaaggtcacgggttcaagttctagaaagagcctcttgtgtaaaaaacaggggaagactgcgta 23580281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 475 - 632
Target Start/End: Complemental strand, 32478942 - 32478793
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatg 574  Q
    ||||||||||||||||||||  || |||||||| |||||| || || ||||| ||||| |||| |||||||||||||| |||     ||||||| |||||    
T  32478942 taaagttgttgtcatgtgac-cgagaggtcacaggttcaagtcctggaaacaacctctagtgt-aaaaacagggtaaggctg-----aatacaccaaatg 32478850  T
Q  575 gtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||| ||| | | ||   |||||||||||||||| ||||||| ||| ||||||    
T  32478849 gtgggaccccttcccggacccagcgtatgcgggagcttt-gtgcaccgggtggccctt 32478793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 473 - 558
Target Start/End: Complemental strand, 42164307 - 42164224
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcg 558  Q
    |||||| ||||||||||||||| |||||||||||  |||||| || || ||||| ||||||||||| ||||||||||||| |||||    
T  42164307 ggtaaaattgttgtcatgtgac-tgaaaggtcacgggttcaagtcttggaaacaacctcttgtgta-aaaacagggtaaggctgcg 42164224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 529 - 582
Target Start/End: Complemental strand, 48327869 - 48327814
Alignment:
Q  529 ctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aatggtgggacc 582  Q
    ||||||||||||||||||||||||||||| |||||||||| |  ||||||||||||    
T  48327869 ctcttgtgtaaaaaacagggtaagactgcatacaatacaccaataatggtgggacc 48327814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 473 - 542
Target Start/End: Complemental strand, 17315457 - 17315389
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaa 542  Q
    |||||||||||||||||||||| |||||||||||  |||||| || |  ||||| |||||||||||||||    
T  17315457 ggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaattcctcgaaacaacctcttgtgtaaaaa 17315389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 571 - 632
Target Start/End: Complemental strand, 38755970 - 38755909
Alignment:
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || | |||||||||||||||||||||||| ||||||||||    
T  38755970 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 38755909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 509 - 583
Target Start/End: Complemental strand, 30581591 - 30581515
Alignment:
Q  509 gttcaaatcgtgtaaacagcctcttgtgtaa-aaaacagggtaagactgcgtacaataca-ctaaatggtgggaccc 583  Q
    |||||| ||||| ||||| |||||||||||| |||||||||||||  || |||||||||| | ||||||||||||||    
T  30581591 gttcaagtcgtggaaacaacctcttgtgtaaaaaaacagggtaagggtgtgtacaatacaccaaaatggtgggaccc 30581515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 482 - 617
Target Start/End: Complemental strand, 32629418 - 32629285
Alignment:
Q  482 gttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa-tggtggga 580  Q
    ||||||||||||| |||||||||||  ||||||||| |  ||||||||||||||  ||||||||||||||| | || ||| |||||| ||| ||| ||||    
T  32629418 gttgtcatgtgac-tgaaaggtcacgggttcaaatcctcgaaacagcctcttgt-aaaaaaacagggtaaggccgcctac-atacaccaaattggcggga 32629322  T
Q  581 ccctttcgcagcccttacgtatgcgggagctttagtg 617  Q
    ||| ||| | | |||| |||||| ||||| |||||||    
T  32629321 ccccttcccggaccttgcgtatgtgggagttttagtg 32629285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 473 - 557
Target Start/End: Original strand, 43035224 - 43035307
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgc 557  Q
    |||||||||||||||| ||||| |||||||||||  |||||| ||  | ||||| |||||||||||| ||||| |||||| ||||    
T  43035224 ggtaaagttgttgtcacgtgac-tgaaaggtcacgggttcaagtccaggaaacaacctcttgtgtaagaaacacggtaaggctgc 43035307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 477 - 568
Target Start/End: Original strand, 51420553 - 51420644
Alignment:
Q  477 aagttgttgtcatgtgacatgaaaggtcacaag-ttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    |||||||||||| ||||| ||||||||||   | ||||| || || ||||| ||||||||||| ||||||||||||| ||| |||||||||||    
T  51420553 aagttgttgtcacgtgac-tgaaaggtcagttgattcaagtcatggaaacaacctcttgtgtagaaaacagggtaaggctgggtacaatacac 51420644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 598 - 641
Target Start/End: Original strand, 35532092 - 35532135
Alignment:
Q  598 cgtatgcgggagctttagtgcaccaggttgcccttattgttttt 641  Q
    |||||||||||||||||||||||| |||||||||| || |||||    
T  35532092 cgtatgcgggagctttagtgcaccgggttgcccttttttttttt 35532135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 598 - 632
Target Start/End: Original strand, 11394952 - 11394986
Alignment:
Q  598 cgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||||||||||||||| ||||||||||    
T  11394952 cgtatgcgggagctttagtgcaccgggttgccctt 11394986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 598 - 632
Target Start/End: Original strand, 11404679 - 11404713
Alignment:
Q  598 cgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||||||||||||||| ||||||||||    
T  11404679 cgtatgcgggagctttagtgcaccgggttgccctt 11404713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 562 - 632
Target Start/End: Original strand, 38786673 - 38786743
Alignment:
Q  562 aatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||| |||||||||||||| ||| | | || | | |||||||||||| ||||||||| ||||||||||    
T  38786673 aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 38786743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 598 - 632
Target Start/End: Complemental strand, 40553972 - 40553938
Alignment:
Q  598 cgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||||||||||||||| ||||||||||    
T  40553972 cgtatgcgggagctttagtgcaccgggttgccctt 40553938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 476 - 581
Target Start/End: Complemental strand, 49938594 - 49938490
Alignment:
Q  476 aaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatg 574  Q
    ||||||||||||| ||||| ||||||||||||  ||||| || || || |||| | ||||||||||| ||||||||| |||||| |||| || | |||||    
T  49938594 aaagttgttgtcacgtgac-tgaaaggtcacagattcaagtcttggaagcagcgtattgtgtaaaaa-cagggtaaggctgcgtccaattcatcaaaatg 49938497  T
Q  575 gtgggac 581  Q
    |||||||    
T  49938496 gtgggac 49938490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 473 - 543
Target Start/End: Complemental strand, 54640498 - 54640429
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa 543  Q
    |||||| ||||||||| ||| | |||||||||||  |||||| || || ||||||||||||||||||||||    
T  54640498 ggtaaaattgttgtcacgtggc-tgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaa 54640429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 571 - 632
Target Start/End: Complemental strand, 33836549 - 33836488
Alignment:
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || | |||||||||||||||||||||| | ||||||||||    
T  33836549 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccctt 33836488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 86; Significance: 2e-40; HSPs: 62)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 86; E-Value: 2e-40
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 8455477 - 8455317
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  |||||| || || |||||||||||||||||||| |||||||||| ||||||||||||||| |    
T  8455477 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacacagggtaaggctgcgtacaatacacca 8455379  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || | ||||||| |||||||||||||||| ||||||||||    
T  8455378 aatggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttgccctt 8455317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 86; E-Value: 2e-40
Query Start/End: Original strand, 446 - 632
Target Start/End: Original strand, 14530267 - 14530454
Alignment:
Q  446 tgtttgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaaca 545  Q
    ||||||||||| ||||||| |  | |||||||||||||||||||||||| |||||||||||  |||||| || || |||||||||||||| |||||||||    
T  14530267 tgtttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaca 14530365  T
Q  546 gggtaagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||| || |||||||||||| |  ||||||||||||| ||| | | || | |||||||||||||||||||||||| ||||||||||    
T  14530366 gggtaaggctacgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 14530454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 85; E-Value: 6e-40
Query Start/End: Original strand, 473 - 632
Target Start/End: Original strand, 9671156 - 9671313
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    ||||||||||||||||||||||  |||| |||||  ||||||||| || ||||||||||||||||||||  ||||||||| ||||||||||||||| |||    
T  9671156 ggtaaagttgttgtcatgtgactggaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaa 9671253  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||| ||| | | || | |||||||||||||||||||||||| ||||||||||    
T  9671254 tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 9671313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 82; E-Value: 4e-38
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 11514410 - 11514569
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  |||||| || || ||||||||||||||||||||||||  ||||| ||||||||||||||| |    
T  11514410 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaactcctggaaacagcctcttgtgtaaaaaacaaagtaaggctgcgtacaatacacca 11514508  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| ||| || | |||||||||||||||||||||||| | ||||||||    
T  11514509 aatggtgggaccc-ttcccagaccctgcgtatgcgggagctttagtgcaccggattgccctt 11514569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 475 - 632
Target Start/End: Original strand, 10543676 - 10543834
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaa 572  Q
    |||||||||||||||||||| |||||||||||  |||||| || || |||| |||||||||||||||||||||||||| |||||||||||||||   |||    
T  10543676 taaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacggcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaa 10543774  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||| ||| | | || | |||||||||||||||||||||||| ||||||||||    
T  10543775 tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 10543834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 23397740 - 23397898
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| ||||||||||   |||||| || || |||||||||||||||||||| |  ||||||| || |||||||||||| |    
T  23397740 ctggtaaagttgttgtcatgtgac-tgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaata--gggtaaggctacgtacaatacacca 23397836  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || ||| |||||||||||| ||||||||| ||||||||||    
T  23397837 aatggtgggaccccttctcggaccctacatatgcgggagctctagtgcaccgggttgccctt 23397898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 471 - 583
Target Start/End: Complemental strand, 12024079 - 12023969
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |||||||||||  |||||| || || ||||||||||||||||||||| ||||||||| ||||||||||||||| |    
T  12024079 ctggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacacca 12023982  T
Q  571 aatggtgggaccc 583  Q
    |||||||||||||    
T  12023981 aatggtgggaccc 12023969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 24200786 - 24200624
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac-- 568  Q
    |||||||||||||||||||||||| ||||| |||||  |||||| || || ||||||||||||||||||||||||||||||| |||||||||||||||      
T  24200786 ctggtaaagttgttgtcatgtgac-tgaaaagtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca 24200688  T
Q  569 taaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
     ||||||||||| || ||| | | || |  ||||| | ||||||||||||||| ||||||||||    
T  24200687 aaaatggtgggaacccttcccggaccctgagtatgtgagagctttagtgcaccgggttgccctt 24200624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 496 - 624
Target Start/End: Complemental strand, 32781425 - 32781298
Alignment:
Q  496 tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccct 595  Q
    ||||||||||| ||||||| ||  | ||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| ||| ||     
T  32781425 tgaaaggtcacgagttcaagtctcggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccagaccc 32781326  T
Q  596 tacgtatgcgggagctttagtgcaccagg 624  Q
    |  ||||||||||||||| ||||||||||    
T  32781325 tgtgtatgcgggagcttt-gtgcaccagg 32781298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 68; E-Value: 8e-30
Query Start/End: Original strand, 450 - 632
Target Start/End: Complemental strand, 21779441 - 21779262
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||||||| |  | ||||| |||||||||||||||||| |||||||||||  |||||| || || | ||||||||||||||||||  ||||||    
T  21779441 tgaggggtaaccttggcgcaactggtgaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggagacagcctcttgtgtaaaa--cagggt 21779345  T
Q  550 aagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||  |||||||||||||| |||||||||||||| ||| | | || | | |||||||||||| ||||||||| ||||||||||    
T  21779344 aaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 21779262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 496 - 632
Target Start/End: Original strand, 10546160 - 10546297
Alignment:
Q  496 tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaa-aacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccc 594  Q
    |||||||||||  |||||| || || ||||| |||||||| ||||| ||||||||||| ||||||||||||||| |||||||||||||| ||| | | ||    
T  10546160 tgaaaggtcacgggttcaagtcctggaaacatcctcttgtataaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggacc 10546259  T
Q  595 ttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
     | |||||||||||||||||||||||| ||||||||||    
T  10546260 ctgcgtatgcgggagctttagtgcaccgggttgccctt 10546297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 499 - 632
Target Start/End: Original strand, 14444730 - 14444862
Alignment:
Q  499 aaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttac 598  Q
    ||||||||  |||||| || || |||||||||||||||||||| |||||||||| ||| |||| |||||| |||||||||||||| ||| | | || | |    
T  14444730 aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-acagggtaaggctgtgtacgatacaccaaatggtgggaccccttcccggaccctgc 14444828  T
Q  599 gtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||||||||||||||||||||||||    
T  14444829 gtatgcgggagctttagtgcaccaggttgccctt 14444862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 17667976 - 17668136
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  |||||| || || ||| | ||||||||||||||| ||||||||| ||||||||||||||| |    
T  17667976 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctggaaagaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacacca 17668074  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||| |||| ||| |   || | |||||  ||||||||||||||||| ||||||||||    
T  17668075 aatggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgggttgccctt 17668136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 472 - 641
Target Start/End: Complemental strand, 25249897 - 25249730
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaa 571  Q
    ||||||||||||||||||||||| || ||||||||  |||||| || || |||||| |||||||||| ||| ||||||||| ||||||||||||||| ||    
T  25249897 tggtaaagttgttgtcatgtgac-tgtaaggtcacgggttcaagtcatggaaacagtctcttgtgtacaaa-cagggtaaggctgcgtacaatacaccaa 25249800  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcccttattgttttt 641  Q
    ||||||||| || ||| |   || | |||||||| ||||||||||||||| |||||||||| || |||||    
T  25249799 atggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgcccttttttttttt 25249730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 522 - 632
Target Start/End: Complemental strand, 40762345 - 40762235
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||||||||||||||||| ||||||| || |||||||||||| ||||||||||||||||||   | || | |||||| |||||||||||||||||    
T  40762345 aaacagcctcttgtgtaaaaaactgggtaaggctacgtacaatacaccaaatggtgggaccctttcctggaccctgcgtatgtgggagctttagtgcacc 40762246  T
Q  622 aggttgccctt 632  Q
     ||||||||||    
T  40762245 gggttgccctt 40762235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 449 - 632
Target Start/End: Complemental strand, 25079901 - 25079718
Alignment:
Q  449 ttgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagg 547  Q
    |||||||| ||||||| |  | |||||||||||||||||||||||| || ||||||||  |||||| || |  ||||| |||||||||||||||| || |    
T  25079901 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcttagaaacaacctcttgtgtaaaaaaacaag 25079803  T
Q  548 gtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||  ||||||||||||||  ||||||||||||| ||| | | || | |||||||  ||||||||||||||| ||||||||||    
T  25079802 gtaaggatgcgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgccctt 25079718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 473 - 583
Target Start/End: Complemental strand, 21377232 - 21377123
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||||||||||||| |||||||| || ||||||| || |  ||||| ||||||||||||||||||||||||| ||| ||||||| ||| |||    
T  21377232 ggtaaagttgttgtcatgtgac-tgaaaggttacgagttcaagtcatagaaacatcctcttgtgtaaaaaacagggtaaggctgggtacaatgcaccaaa 21377134  T
Q  573 tggtgggaccc 583  Q
    |||||||||||    
T  21377133 tggtgggaccc 21377123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 522 - 632
Target Start/End: Original strand, 36871517 - 36871625
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    |||||||||||||||| |||| ||||||||| ||||||||||||||| |||||||||||||| ||| | | || | ||||||||||||||||||||||||    
T  36871517 aaacagcctcttgtgtgaaaa-cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggacc-tgcgtatgcgggagctttagtgcacc 36871614  T
Q  622 aggttgccctt 632  Q
     ||||||||||    
T  36871615 gggttgccctt 36871625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 58; E-Value: 8e-24
Query Start/End: Original strand, 471 - 629
Target Start/End: Original strand, 7214508 - 7214667
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac-- 568  Q
    |||||||||||||||||||||||| ||||||||||   |||||| || || |||||| ||||||||||||| |||||||||| |||||||||||||||      
T  7214508 ctggtaaagttgttgtcatgtgac-tgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaatacagggtaaggctgcgtacaatacacaa 7214606  T
Q  569 taaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcc 629  Q
     |||||||| || || ||| | | |  | |||||||| ||| |||||||||||||||||||    
T  7214607 aaaatggtgagatcccttctcggacactgcgtatgcgagagttttagtgcaccaggttgcc 7214667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 58; E-Value: 8e-24
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 19977875 - 19977715
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    ||||| ||||||||||||||||||  ||||||||||  |||||| |  || |||||||||||| ||||||||| ||| ||||  |||||||||||||| |    
T  19977875 ctggtgaagttgttgtcatgtgacc-gaaaggtcacgggttcaagttctggaaacagcctcttttgtaaaaaataggataaggttgcgtacaatacacca 19977777  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||| || ||| |   ||||  ||||||||||||||||||||||||| || |||||    
T  19977776 aatggtgggatcccttcccgaaccttgtgtatgcgggagctttagtgcaccagattaccctt 19977715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 57; E-Value: 3e-23
Query Start/End: Original strand, 472 - 632
Target Start/End: Original strand, 14544038 - 14544200
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgta-aaaaacagggtaagactgcgtacaata--cac 568  Q
    ||||||||||||||||||||||| |||||||| ||| || ||  |  || ||||||||||||||||| ||||||||||||||||||||| |||||  ||     
T  14544038 tggtaaagttgttgtcatgtgac-tgaaaggttacaggtccaggtactggaaacagcctcttgtgtagaaaaacagggtaagactgcgtgcaataaccaa 14544136  T
Q  569 taaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
     ||||||| |||||| |||   | || | ||||||||||||||||||||||||| |||||||||    
T  14544137 aaaatggtcggaccccttccgggaccctgcgtatgcgggagctttagtgcaccaagttgccctt 14544200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 57; E-Value: 3e-23
Query Start/End: Original strand, 453 - 632
Target Start/End: Original strand, 17896215 - 17896394
Alignment:
Q  453 ggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaac-agggtaa 551  Q
    |||| |||||||||  | ||||||||||||||||||||||||  ||||||||||   ||||| || |  ||||| ||||||||||||||||  |||||||    
T  17896215 ggggtaaccttgacgcaactggtaaagttgttgtcatgtgacc-gaaaggtcacggattcaagtcctagaaacaacctcttgtgtaaaaaaatagggtaa 17896313  T
Q  552 gactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    | |||||||||||| || |||||||||||||| ||| | | || | |||||| ||||||||||||||| |  |||||||||    
T  17896314 ggctgcgtacaatataccaaatggtgggaccccttctcggaccctgcgtatgtgggagctttagtgcatcgagttgccctt 17896394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 57; E-Value: 3e-23
Query Start/End: Original strand, 472 - 632
Target Start/End: Complemental strand, 40417031 - 40416872
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaa 571  Q
    ||||||||||||||||||||||| || ||||||||  |||||| || || ||||| |||||||| |||||||||||| ||| ||| ||||||||||| ||    
T  40417031 tggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcatggaaacaacctcttgtataaaaaacagggaaaggctgtgtacaatacaccaa 40416933  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
     || |||||||||||    | || | | |||||| ||||||||||||||| ||||||||||    
T  40416932 ttgatgggacccttttttggaccctgcatatgcgagagctttagtgcaccgggttgccctt 40416872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 533 - 632
Target Start/End: Original strand, 25632544 - 25632643
Alignment:
Q  533 tgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||||| |||| ||||||||||||||| |||||||||||  | ||| |   ||||||||||||||||||||||||||||| ||||||||||    
T  25632544 tgtgtaaaaaacaggataaggctgcgtacaatacaccaaatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgccctt 25632643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 473 - 587
Target Start/End: Complemental strand, 23145857 - 23145744
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    ||||||||||||||   ||||| |||||||||||  |||||| || || |||||| |||||||||||||||||| ||||| ||||||||||||||| ||     
T  23145857 ggtaaagttgttgtagcgtgac-tgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaat 23145759  T
Q  573 tggtgggaccctttc 587  Q
    |||||||||||||||    
T  23145758 tggtgggaccctttc 23145744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 473 - 587
Target Start/End: Complemental strand, 23557647 - 23557534
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    ||||||||||||||   ||||| |||||||||||  |||||| || || |||||| |||||||||||||||||| ||||| ||||||||||||||| ||     
T  23557647 ggtaaagttgttgtagcgtgac-tgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaat 23557549  T
Q  573 tggtgggaccctttc 587  Q
    |||||||||||||||    
T  23557548 tggtgggaccctttc 23557534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 39914467 - 39914307
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacact 569  Q
    |||||||||||||||||||||||| || ||||||||  | |||| |  || ||||| |||||||||||||||| |||||||||  || |||||||||||     
T  39914467 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggatcaagtactggaaacaacctcttgtgtaaaaaaacagggtaaggatgtgtacaatacacc 39914369  T
Q  570 aaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
     ||||||||||||| ||| | | || | |||||||||||||||||||||| | ||||||||||    
T  39914368 gaatggtgggaccccttc-ctgaccctgcgtatgcgggagctttagtgcatcgggttgccctt 39914307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 473 - 630
Target Start/End: Complemental strand, 4516510 - 4516354
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||||||| ||||| ||||||||||||  ||||| |  |  ||||||||||||||||||||||||||| ||  ||||||||||||||| ||     
T  4516510 ggtaaagttgttgtcacgtgac-tgaaaggtcacatattcaagttctagaaacagcctcttgtgtaaaaaacagggcaacgctgcgtacaatacaccaat 4516412  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccc 630  Q
    ||||||||||| ||| | | || | |||||| || |||||||||| ||| || |||||    
T  4516411 tggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtaccgggctgccc 4516354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 475 - 583
Target Start/End: Original strand, 5450263 - 5450371
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaat 573  Q
    |||||||||||||||||||| |||||||||||  |||||| || || ||||| |||||||||||||||| || |||||| ||||||||||||||| |||     
T  5450263 taaagttgttgtcatgtgac-tgaaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaaacatggtaaggctgcgtacaatacaccaaag 5450361  T
Q  574 ggtgggaccc 583  Q
    ||||||||||    
T  5450362 ggtgggaccc 5450371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 17623538 - 17623698
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||| ||| || ||||||||  |||||| || |  ||||| ||||||||||||||| ||||||||| ||||||||||||||| |    
T  17623538 ctggtaaagttgttgtcatgcgac-tggaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacacca 17623636  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||| |||| ||| |    | | |||||| || |||||||||||||  ||||||||||    
T  17623637 aatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcactgggttgccctt 17623698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 27573595 - 27573754
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| ||||||||||   |||||| ||  |  |||||||||||||||| ||| || |||||| ||||||||||||||| |    
T  27573595 ctggtaaagttgttgtcatgtgac-tgaaaggtcattggttcaagtccgggcaacagcctcttgtgtataaa-catggtaaggctgcgtacaatacacca 27573692  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||| ||| |||| ||  || |  ||||| ||||||||||||||| | ||||||||||    
T  27573693 aatggtggaaccatttcccaaaccctgtgtatgtgggagctttagtgcatcgggttgccctt 27573754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 475 - 621
Target Start/End: Complemental strand, 31158598 - 31158451
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac--taaa 572  Q
    |||||||||||||||||||| ||||||||||   ||| || || |  ||||||||||||| |||||||||||||||||| ||| ||||||| ||   |||    
T  31158598 taaagttgttgtcatgtgac-tgaaaggtcaagggttaaagtcttcaaaacagcctcttgcgtaaaaaacagggtaagattgcatacaataaaccaaaaa 31158500  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||||| ||| ||| || | ||||||||||||||||||| ||||    
T  31158499 tggtgggaccccttcccagaccctgcgtatgcgggagctttagtacacc 31158451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 474 - 617
Target Start/End: Complemental strand, 99421 - 99281
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaat 573  Q
    ||||||||||||||| ||||| |||||||||||  |||||| || |  ||||||||||||||  |||||||| || ||| ||||||||||||||| ||||    
T  99421 gtaaagttgttgtcacgtgac-tgaaaggtcacgggttcaagtcctagaaacagcctcttgt--aaaaaacatggcaaggctgcgtacaatacaccaaat 99325  T
Q  574 ggtgggaccctttcgcagcccttacgtatgcgggagctttagtg 617  Q
    ||||| |||| ||| ||| || |  |||||||||||||||||||    
T  99324 ggtggaaccccttctcagaccctgtgtatgcgggagctttagtg 99281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 450 - 583
Target Start/End: Original strand, 22371010 - 22371139
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||||||| |  | |||||||||||||||||||||||| ||  |||||||  |||||| || || |||||||||| |||   |||||||||||    
T  22371010 tgaggggtaaccttggcccaactggtaaagttgttgtcatgtgac-tgggaggtcacgggttcaagtcctggaaacagcctcgtgt---aaaaacagggt 22371105  T
Q  550 aagactgcgtacaatacactaaatggtgggaccc 583  Q
    ||| ||||||||||||||| ||||||||||||||    
T  22371106 aaggctgcgtacaatacaccaaatggtgggaccc 22371139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 522 - 632
Target Start/End: Original strand, 30826061 - 30826169
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    |||||||||||||||||||||  ||||||||  |||||||||||||| ||||||||| |||| ||| ||| || ||| ||||||||||||||||||||||    
T  30826061 aaacagcctcttgtgtaaaaat-agggtaaggttgcgtacaatacaccaaatggtggaaccc-ttcccagaccctacatatgcgggagctttagtgcacc 30826158  T
Q  622 aggttgccctt 632  Q
    || ||| ||||    
T  30826159 agattgtcctt 30826169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 474 - 630
Target Start/End: Complemental strand, 45235976 - 45235820
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaa-aacagggtaagactgcgtacaatacactaaa 572  Q
    ||||||||||| ||||||||| |||||| |||| ||||||| || |  |||||| ||||| ||||||| || |||||||| || |||  ||||||| |||    
T  45235976 gtaaagttgttctcatgtgac-tgaaagatcacgagttcaagtcctagaaacagtctcttctgtaaaataatagggtaaggctacgtgtaatacacaaaa 45235878  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccc 630  Q
    ||||||||||| ||  ||| || ||||||||| |||||||||||| |||| |||||||    
T  45235877 tggtgggaccccttaccagaccctacgtatgcaggagctttagtgtaccaagttgccc 45235820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 475 - 632
Target Start/End: Original strand, 5841006 - 5841164
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--aa 572  Q
    |||||||||||||||||||| || ||||||||  |||||| || |  ||||||||| |||||||||||| ||||||||  |||||||||||||  |  ||    
T  5841006 taaagttgttgtcatgtgac-tggaaggtcacgggttcaagtcctagaaacagccttttgtgtaaaaaatagggtaaggatgcgtacaatacatcaataa 5841104  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||| ||| | | ||   | ||||||||||||||||||||||  |||||||||    
T  5841105 tggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccctt 5841164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 471 - 621
Target Start/End: Complemental strand, 26684783 - 26684632
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacag-cctcttgtgtaaaaaac-agggtaagactgcgtacaatacac 568  Q
    |||||||||||||||||||||||  |||||||||| | ||| || || || |||||| ||||||||||||||||  | |||||| |||||||||||| ||    
T  26684783 ctggtaaagttgttgtcatgtgat-tgaaaggtcaaaggtttaagtcctgaaaacagacctcttgtgtaaaaaaatatggtaaggctgcgtacaatatac 26684685  T
Q  569 taaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||||||||  ||| |   || | ||||||||||||||||| ||||||    
T  26684684 taaatggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcacc 26684632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 473 - 614
Target Start/End: Complemental strand, 44521532 - 44521392
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||| ||| ||||| |||||||||||  ||||||||| || |||||  ||||||||||||||||| |||||| |||| || ||||||| |||    
T  44521532 ggtaaagttgttatcacgtgac-tgaaaggtcacgcgttcaaatcttggaaacaatctcttgtgtaaaaaacaaggtaaggctgcatataatacaccaaa 44521434  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagcttta 614  Q
    ||| |||| || ||| ||| | || | ||| |||||||||||    
T  44521433 tggcgggagcccttcccagacattgcatatacgggagcttta 44521392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 472 - 632
Target Start/End: Original strand, 44643497 - 44643657
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacacta 570  Q
    ||||||||||||  ||||||||| |||||||||||  |||||| |  |  ||| ||||||||  |||||||| ||| ||||| |||||||||||  || |    
T  44643497 tggtaaagttgtcatcatgtgac-tgaaaggtcacgtgttcaagttctagaaagagcctcttccgtaaaaaaacagagtaaggctgcgtacaatgtacca 44643595  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| ||| || | ||||||||||||| |||||||||| || |||||||    
T  44643596 aatggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgccctt 44643657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 473 - 552
Target Start/End: Complemental strand, 29420048 - 29419970
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaag 552  Q
    ||||||||||||||||  |||| ||||||||||| ||||||| || || ||||| |||||||||||||||||||||||||    
T  29420048 ggtaaagttgttgtcacatgac-tgaaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaag 29419970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 471 - 568
Target Start/End: Original strand, 17705469 - 17705565
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    ||||||||||||||||||||||||  ||| ||||||  |||||| || || |||| |||||||||||||| ||||| ||||| ||| |||||||||||    
T  17705469 ctggtaaagttgttgtcatgtgactagaa-ggtcacgggttcaagtcctggaaaccgcctcttgtgtaaacaacagagtaaggctgtgtacaatacac 17705565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 473 - 613
Target Start/End: Original strand, 33795261 - 33795400
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtac-aatacactaa 571  Q
    |||||||||||||||| ||||  |||||||||||  |||||| ||  | ||||| ||||||| ||||||||||||||||| |||||||| |||||||       
T  33795261 ggtaaagttgttgtcacgtgat-tgaaaggtcacgggttcaagtcccggaaacaacctcttgggtaaaaaacagggtaaggctgcgtacaaatacac-ct 33795358  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagcttt 613  Q
    |||||||||||| ||| ||| || |  |||||||||||||||    
T  33795359 atggtgggaccccttcccagaccctgtgtatgcgggagcttt 33795400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 486 - 565
Target Start/End: Original strand, 19614981 - 19615059
Alignment:
Q  486 tcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaata 565  Q
    ||||||||| |||||||||||  |||||| || |  ||||| |||||||| |||||||||||||||||||||||||||||    
T  19614981 tcatgtgac-tgaaaggtcacgggttcaagtccttgaaacatcctcttgtataaaaaacagggtaagactgcgtacaata 19615059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 475 - 553
Target Start/End: Original strand, 44604832 - 44604908
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaaga 553  Q
    |||||||||||||||||||| || ||||||||| |||||| || || ||||| |||||||||| |||||||||||||||    
T  44604832 taaagttgttgtcatgtgac-tggaaggtcacaggttcaagtcctggaaacaacctcttgtgt-aaaaacagggtaaga 44604908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 497 - 573
Target Start/End: Complemental strand, 12315787 - 12315712
Alignment:
Q  497 gaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaat 573  Q
    |||||||||| ||||||| || || ||||||| |||| | |||||||||||||||||||| ||||||||||| ||||    
T  12315787 gaaaggtcacgagttcaagtcatggaaacagcttcttat-taaaaaacagggtaagactgtgtacaatacaccaaat 12315712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 471 - 621
Target Start/End: Complemental strand, 24860147 - 24860000
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||| ||||||||||||||| || ||||| ||  ||| ||  | || ||||| ||||| ||||||||| || |||| | ||||||||||||||| |    
T  24860147 ctggtaaaattgttgtcatgtgac-tggaaggttacgggtttaagccctggaaacaacctctggtgtaaaaa-catggtagg-ctgcgtacaatacacca 24860051  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    |||||| | |||| ||| | | || | ||||||||||||||||||||||||    
T  24860050 aatggtagaaccccttctcggaccctgcgtatgcgggagctttagtgcacc 24860000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 538 - 620
Target Start/End: Original strand, 24890451 - 24890533
Alignment:
Q  538 aaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    |||||||| |||||| |||| |||||||||| || ||||||||||| ||| | | || | ||||||| |||||||||||||||    
T  24890451 aaaaaacaaggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac 24890533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 482 - 583
Target Start/End: Complemental strand, 31821491 - 31821393
Alignment:
Q  482 gttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggac 581  Q
    ||||| ||||||| ||||||||||| ||||||| ||||  ||||||||   ||||||||||| ||||||||  || ||||||||||| ||||| ||||||    
T  31821491 gttgttatgtgac-tgaaaggtcacgagttcaagtcgtagaaacagccg--tgtgtaaaaaatagggtaaggttgtgtacaatacaccaaatgatgggac 31821395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 547 - 632
Target Start/End: Complemental strand, 13245181 - 13245096
Alignment:
Q  547 ggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||| ||||||||| |||||||||||||||||||| ||| | | || | | ||| |||||||||||||| | | ||||||||||    
T  13245181 ggtaaggctgcgtacattacactaaatggtgggaccccttcccggaccatgcatatacgggagctttagtgtatcgggttgccctt 13245096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 522 - 621
Target Start/End: Original strand, 17471572 - 17471673
Alignment:
Q  522 aaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgca 619  Q
    |||||||||||||||||||||| |||| ||||||||||||||||| | | ||||| || ||||| ||| | | || | | |||||||||| |||||||||    
T  17471572 aaacagcctcttgtgtaaaaaaacaggataagactgcgtacaatataccaaaatgatgagaccccttccctgaccctgcctatgcgggagttttagtgca 17471671  T
Q  620 cc 621  Q
    ||    
T  17471672 cc 17471673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 482 - 583
Target Start/End: Original strand, 25641487 - 25641586
Alignment:
Q  482 gttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggac 581  Q
    ||||||||||||| |||||||||||  |||||| || || ||||||| | |||||| |||| ||||||||   |||||||||||||| |||| |||||||    
T  25641487 gttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcattttgtgtgaaaa-cagggtaaagttgcgtacaatacaccaaattgtgggac 25641584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 474 - 632
Target Start/End: Original strand, 4795730 - 4795889
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacactaaa 572  Q
    ||||||||||||||| ||||| ||||| |||||  ||| || || || |||||||||| || |||||||| || | | ||||||||| |||||||| |||    
T  4795730 gtaaagttgttgtcacgtgac-tgaaaagtcacttgttgaagtcttgaaaacagcctcatgcgtaaaaaaacaagattagactgcgtgcaatacaccaaa 4795828  T
Q  573 -tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
     |||||||||| |||| | | ||||  |||||| | ||||||||||||   ||||||||||    
T  4795829 atggtgggaccttttcccggaccttgtgtatgccgaagctttagtgcagtgggttgccctt 4795889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 599 - 635
Target Start/End: Complemental strand, 40579783 - 40579747
Alignment:
Q  599 gtatgcgggagctttagtgcaccaggttgcccttatt 635  Q
    ||||||||||||||||||||||| |||||||||||||    
T  40579783 gtatgcgggagctttagtgcaccgggttgcccttatt 40579747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 522 - 565
Target Start/End: Complemental strand, 15296518 - 15296475
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaata 565  Q
    ||||||||| |||||||||| |||||||||| ||||||||||||    
T  15296518 aaacagcctgttgtgtaaaatacagggtaaggctgcgtacaata 15296475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 598 - 632
Target Start/End: Original strand, 8575995 - 8576029
Alignment:
Q  598 cgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||| ||||||||||||||||||||||||||||    
T  8575995 cgtatgtgggagctttagtgcaccaggttgccctt 8576029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 477 - 583
Target Start/End: Complemental strand, 17380391 - 17380287
Alignment:
Q  477 aagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggt 576  Q
    ||||||||||||||||||  ||||||||||  |||||| || || ||||| |||||||||| | ||||||||||||  || || |||||||| ||||| |    
T  17380391 aagttgttgtcatgtgacc-gaaaggtcacgggttcaagtcttggaaacaacctcttgtgt-ataaacagggtaaggttgtgtgcaatacaccaaatgat 17380294  T
Q  577 gggaccc 583  Q
    || ||||    
T  17380293 ggaaccc 17380287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 598 - 632
Target Start/End: Original strand, 22371212 - 22371246
Alignment:
Q  598 cgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||||||||||||||| ||||||||||    
T  22371212 cgtatgcgggagctttagtgcaccgggttgccctt 22371246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 936 - 973
Target Start/End: Original strand, 9699733 - 9699770
Alignment:
Q  936 ttcagtgatgaaaatccaaatgcttgttctattatgta 973  Q
    ||||||||||| |||||||||||||||||| |||||||    
T  9699733 ttcagtgatgagaatccaaatgcttgttctgttatgta 9699770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 473 - 506
Target Start/End: Original strand, 35017793 - 35017826
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcac 506  Q
    |||||||||||||||||||||| |||||||||||    
T  35017793 ggtaaagttgttgtcatgtgacttgaaaggtcac 35017826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 441 - 494
Target Start/End: Complemental strand, 39189612 - 39189559
Alignment:
Q  441 tagtttgtttgaggggaaaccttgacatagctggtaaagttgttgtcatgtgac 494  Q
    ||||||| |||||||| ||||||| |  | ||||||||||||||||||||||||    
T  39189612 tagtttgattgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac 39189559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 931 - 972
Target Start/End: Complemental strand, 40787097 - 40787056
Alignment:
Q  931 aaatgttcagtgatgaaaatccaaatgcttgttctattatgt 972  Q
    ||||||| |||||||||||||| |||||||||||| ||||||    
T  40787097 aaatgtttagtgatgaaaatcctaatgcttgttctgttatgt 40787056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 82; Significance: 4e-38; HSPs: 39)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 82; E-Value: 4e-38
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 12222078 - 12221915
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |||||||||||  |||||| || || ||||||||||||||||||||||||||||||| ||||||||||||||| |    
T  12222078 ctggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca 12221980  T
Q  571 --aatggtgggaccctttcgcagcccttacgtatgcgggagc-tttagtgcaccaggttgccctt 632  Q
      ||||||||||||| ||| | | || | ||||||||||||| ||||||||||| ||||||||||    
T  12221979 ataatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccctt 12221915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 471 - 632
Target Start/End: Complemental strand, 1354916 - 1354758
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |||||||||||  |||||| || || ||||||||||||||||||||  ||||||||| ||||||||||||||| |    
T  1354916 ctggtaaagttgttgtcatgtgac-tgaaaggtcactggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacca 1354820  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || | | |||||||||||| ||||||||| ||||||||||    
T  1354819 aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 1354758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 450 - 632
Target Start/End: Complemental strand, 29356040 - 29355856
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaag-ttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacaggg 548  Q
    ||||||| ||||||| || | ||||||||  ||||||||||||||| |||||||||||  |||||| || || |||||||||||||||||| ||||||||    
T  29356040 tgaggggtaaccttggcacaactggtaaaaattgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacaggg 29355942  T
Q  549 taagactgcgtacaatacacta--aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||| ||||||||||||||| |  ||||||||||||| ||| | | || | |||||||||||||||||||||||| ||||||||||    
T  29355941 taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 29355856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 75; E-Value: 6e-34
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 1346938 - 1347096
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |||||||||||  |||||| || || |||||||| |||||||||||  ||||||||| ||||||||||||||| |    
T  1346938 ctggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagccacttgtgtaaaa--cagggtaaggctgcgtacaatacacca 1347034  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || | | |||||||||||| ||||||||| ||||||||||    
T  1347035 aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 1347096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 75; E-Value: 6e-34
Query Start/End: Original strand, 473 - 632
Target Start/End: Original strand, 9161099 - 9161258
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaa- 571  Q
    |||||||||||||||||||||| |||||||||||| |||||| || || ||||||||||||||||||||| ||| ||||| ||||||||||||||  ||     
T  9161099 ggtaaagttgttgtcatgtgac-tgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaa-cagagtaaggctgcgtacaatacatcaat 9161196  T
Q  572 -atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
     |||||||||||| ||| | | || | ||||||||| |||||||||||||||||||||||||    
T  9161197 aatggtgggaccccttctcggaccctgcgtatgcggaagctttagtgcaccaggttgccctt 9161258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 471 - 626
Target Start/End: Complemental strand, 3815238 - 3815084
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| ||||| |||||  |||||| || || |||||| || |||||||||||| | |||| ||||||||||||||||| |    
T  3815238 ctggtaaagttgttgtcatgtgac-tgaaatgtcacgggttcaagtcctggaaacagactattgtgtaaaaaatatggtacgactgcgtacaatacacca 3815140  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggtt 626  Q
    ||||||||||||||||| |   || ||||||||||| |||||||||||||| ||||    
T  3815139 aatggtgggaccctttcccgaaccctacgtatgcggaagctttagtgcaccgggtt 3815084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 474 - 632
Target Start/End: Complemental strand, 32728314 - 32728158
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaat 573  Q
    ||||||||||||||||||||| ||||||||||||  ||||| |  || ||||| |||||| |||||||||||||||||||||| |||||||| || ||||    
T  32728314 gtaaagttgttgtcatgtgac-tgaaaggtcacagattcaagttttggaaacaacctcttatgtaaaaaacagggtaagactgtgtacaatataccaaat 32728216  T
Q  574 ggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
     || || ||||||| ||| || ||||||||||||| ||||||||||||| |||||||||    
T  32728215 agt-ggtccctttcccagaccctacgtatgcgggaactttagtgcaccatgttgccctt 32728158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 472 - 586
Target Start/End: Original strand, 20400642 - 20400755
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaa 571  Q
    ||||| ||||||||||||||||| |||||||||||| |||||| |  || |||||  |||||||||||||||||||||||||||||||||| ||||||||    
T  20400642 tggtatagttgttgtcatgtgac-tgaaaggtcacaggttcaagttatggaaacaatctcttgtgtaaaaaacagggtaagactgcgtacagtacactaa 20400740  T
Q  572 atggtgggacccttt 586  Q
    || | ||||||||||    
T  20400741 atagcgggacccttt 20400755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 58; E-Value: 8e-24
Query Start/End: Original strand, 474 - 632
Target Start/End: Complemental strand, 2166570 - 2166411
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--a 571  Q
    ||||||||||||| ||||||| |||||||||||  |||||| || || ||||| |||||||||||||| ||||| ||||  |||||||||||||| |  |    
T  2166570 gtaaagttgttgttatgtgac-tgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaata 2166472  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||| ||| | | || ||  ||| |||||||||||||||||| ||||||||||    
T  2166471 atggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccctt 2166411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 58; E-Value: 8e-24
Query Start/End: Original strand, 474 - 632
Target Start/End: Complemental strand, 2178203 - 2178044
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta--a 571  Q
    ||||||||||||| ||||||| |||||||||||  |||||| || || ||||| |||||||||||||| ||||| ||||  |||||||||||||| |  |    
T  2178203 gtaaagttgttgttatgtgac-tgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaata 2178105  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||| ||| | | || ||  ||| |||||||||||||||||| ||||||||||    
T  2178104 atggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccctt 2178044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 498 - 632
Target Start/End: Complemental strand, 18277328 - 18277194
Alignment:
Q  498 aaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagccctta 597  Q
    |||||||||  ||||||||| || ||||||||||||||||||||| |||||||||  || |||||  |||| |||||||||||||| |||  || |  ||    
T  18277328 aaaggtcacgggttcaaatcttggaaacagcctcttgtgtaaaaatcagggtaaggttgagtacagaacaccaaatggtgggaccccttcctagactcta 18277229  T
Q  598 cgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||||||| |||||| ||||| ||||    
T  18277228 cgtatgcgggagctttactgcaccgggttgtcctt 18277194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 471 - 568
Target Start/End: Original strand, 6024207 - 6024303
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    |||||||||||||||||||||||  || ||||||||   |||||||| |  |||||||||||||||||||||||| ||||||||||||||||||||||    
T  6024207 ctggtaaagttgttgtcatgtgat-tggaaggtcacggtttcaaatcctagaaacagcctcttgtgtaaaaaacatggtaagactgcgtacaatacac 6024303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 471 - 583
Target Start/End: Original strand, 1941829 - 1941940
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    ||||||||||||||||||| |||| || |||||| |   || || || |||||||| ||||||||||||||||||||||||| |||||||||||||||      
T  1941829 ctggtaaagttgttgtcatctgac-tggaaggtcgcggattgaagtcatgtaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccg 1941927  T
Q  571 aatggtgggaccc 583  Q
    |||||||||||||    
T  1941928 aatggtgggaccc 1941940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 450 - 566
Target Start/End: Original strand, 8409196 - 8409311
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||||||| |  | |||||||||||||||| ||||||| |||||||||||   ||||| || || |||| |||||||||||||||||||||||    
T  8409196 tgaggggtaaccttggcgcaactggtaaagttgttgtaatgtgac-tgaaaggtcacggattcaagtcctggaaactgcctcttgtgtaaaaaacagggt 8409294  T
Q  550 aagactgcgtacaatac 566  Q
    ||| |||||||||||||    
T  8409295 aaggctgcgtacaatac 8409311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 473 - 587
Target Start/End: Complemental strand, 13905138 - 13905026
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||||||||||||| |||||||||||  | |||| || || ||||  ||||||||||||||||||||||||| |||| |||||| ||| |||    
T  13905138 ggtaaagttgttgtcatgtgac-tgaaaggtcacgggctcaagtcctgaaaacgacctcttgtgtaaaaaacagggtaaggctgcatacaattcaccaaa 13905040  T
Q  573 tggtgggaccctttc 587  Q
    |||| ||||||||||    
T  13905039 tggt-ggaccctttc 13905026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 475 - 583
Target Start/End: Original strand, 28007604 - 28007711
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaa-ggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaat 573  Q
    |||||||||||||||||||||||||| ||||||  |||||| || || ||| ||||||||||||||||  |||||| || ||||||||||||||| ||||    
T  28007604 taaagttgttgtcatgtgacatgaaaaggtcacgggttcaagtcctggaaagagcctcttgtgtaaaa--cagggtcaggctgcgtacaatacaccaaat 28007701  T
Q  574 ggtgggaccc 583  Q
    | ||||||||    
T  28007702 gctgggaccc 28007711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 50; E-Value: 5e-19
Query Start/End: Original strand, 496 - 620
Target Start/End: Complemental strand, 7947509 - 7947384
Alignment:
Q  496 tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaatggtgggaccctttcgcagccc 594  Q
    |||||||||||  |||||| || || ||||| |||| |||||||||| ||||||||| |||||||||||||| | |||||||||| ||| ||| | | ||    
T  7947509 tgaaaggtcaccggttcaactcctggaaacaacctcctgtgtaaaaaccagggtaaggctgcgtacaatacaccaaaatggtgggcccccttcccggacc 7947410  T
Q  595 ttacgtatgcgggagctttagtgcac 620  Q
    || |||||| ||||||||||||||||    
T  7947409 ttgcgtatgtgggagctttagtgcac 7947384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 471 - 611
Target Start/End: Original strand, 14553486 - 14553626
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    ||||||||||||||||||||||||   |||||||||| |||||| || || ||| ||| |||||||||||||| |||||||| ||| ||| ||||||| |    
T  14553486 ctggtaaagttgttgtcatgtgact--aaaggtcacaggttcaagtcctggaaatagcttcttgtgtaaaaaatagggtaaggctgtgtataatacacca 14553583  T
Q  571 aa--tggtgggaccctttcgcagcccttacgtatgcgggagct 611  Q
    ||  ||||||||||| |||| || || |  |||||||||||||    
T  14553584 aaactggtgggaccccttcgtagaccctgtgtatgcgggagct 14553626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 473 - 568
Target Start/End: Original strand, 12889402 - 12889496
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    |||||||||||||||| ||||  |||||||||||| |||||| || || |||||||||||||||| |||||||||| ||| |||| ||||||||||    
T  12889402 ggtaaagttgttgtcacgtgag-tgaaaggtcacaggttcaagtcttgaaaacagcctcttgtgttaaaaacagggcaaggctgcatacaatacac 12889496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 522 - 632
Target Start/End: Original strand, 26097184 - 26097292
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||||||||||||||  ||||||||| ||||||||||||||| |||||  ||||||| ||| | | || | | |||||||||||| |||||||||    
T  26097184 aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatgaagggaccccttcccggaccctgcatatgcgggagctctagtgcacc 26097281  T
Q  622 aggttgccctt 632  Q
     ||||||||||    
T  26097282 gggttgccctt 26097292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 24097555 - 24097711
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||| ||| |||||||| || ||||||||||| |||| || || |  || ||||||||||| |||||||||||||||| |||| ||||    || |    
T  24097555 ctggtaaaattgatgtcatgttac-tgaaaggtcacgagtttaagtcctcgaaccagcctcttgtataaaaaacagggtaaggctgcttaca----acca 24097649  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || | ||||||||| ||||||||||  |||||||||||||    
T  24097650 aatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgtcccaggttgccctt 24097711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 471 - 543
Target Start/End: Original strand, 24734607 - 24734678
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa 543  Q
    |||||||||||||||||||||||| |||||||||| ||||||||||| |  ||||| ||||||||||||||||    
T  24734607 ctggtaaagttgttgtcatgtgac-tgaaaggtcaaaagttcaaatccttgaaacaacctcttgtgtaaaaaa 24734678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 522 - 632
Target Start/End: Original strand, 25557749 - 25557857
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    ||||||||||||||||||||  ||||||||| ||||||||||||||| |||||  || |||| ||| | | || | | |||||||||||| |||||||||    
T  25557749 aaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatgaaggaaccccttcccggaccctgcatatgcgggagctctagtgcacc 25557846  T
Q  622 aggttgccctt 632  Q
     ||||||||||    
T  25557847 gggttgccctt 25557857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 471 - 620
Target Start/End: Complemental strand, 15866198 - 15866052
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    ||||||||||||||| |||||||  ||||||||||   |||||| || || ||||||||||||  ||||||||||||||||  ||||||  ||||||| |    
T  15866198 ctggtaaagttgttggcatgtgat-tgaaaggtcatgggttcaattcctggaaacagcctcttaagtaaaaaacagggtaaagctgcgt--aatacacca 15866102  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    ||||||||||||| ||| | | || | ||| ||||||| || ||||||||    
T  15866101 aatggtgggaccccttcccggaccctgcgtttgcgggatctatagtgcac 15866052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 483 - 620
Target Start/End: Complemental strand, 23240971 - 23240837
Alignment:
Q  483 ttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggacc 582  Q
    |||||| ||||| |||||||||||| || ||| || || ||||||||||||||||  |||||||||||||  ||||||||||| || || ||||||||||    
T  23240971 ttgtcacgtgac-tgaaaggtcacaggtgcaagtcctggaaacagcctcttgtgt--aaaacagggtaagtttgcgtacaatataccaattggtgggacc 23240875  T
Q  583 ctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    | |||   | |  | |||||||||||||||||||||||    
T  23240874 ccttctaggacaatgcgtatgcgggagctttagtgcac 23240837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 509 - 586
Target Start/End: Original strand, 33138844 - 33138921
Alignment:
Q  509 gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggacccttt 586  Q
    |||||| || || ||||| |||||||| |||||||||| ||||| | ||||||||||||| |||||||||||||||||    
T  33138844 gttcaagtcctggaaacaacctcttgtataaaaaacagagtaaggccgcgtacaatacaccaaatggtgggacccttt 33138921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 554 - 632
Target Start/End: Original strand, 12885967 - 12886047
Alignment:
Q  554 ctgcgtacaatacactaaa--tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||||| |||  ||||||||||| ||| ||| || | |||||| ||||||||||||||||| ||||||||||    
T  12885967 ctgcgtacaatacacaaaaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgccctt 12886047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 531 - 572
Target Start/End: Complemental strand, 24751176 - 24751135
Alignment:
Q  531 cttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    ||||||||||||| ||||||||||||||||||||||||||||    
T  24751176 cttgtgtaaaaaatagggtaagactgcgtacaatacactaaa 24751135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 509 - 626
Target Start/End: Original strand, 32579437 - 32579553
Alignment:
Q  509 gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga 608  Q
    |||||| || || ||||||||||| || ||||||  | |||||| ||||||||||||| | |||||||||||||| ||| ||| || | | |||||||||    
T  32579437 gttcaagtcctggaaacagcctctggtataaaaat-acggtaagcctgcgtacaataccccaaatggtgggaccccttcccagaccctgcatatgcggga 32579535  T
Q  609 gctttagtgcaccaggtt 626  Q
    |||||||| | |||||||    
T  32579536 gctttagtactccaggtt 32579553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 556 - 632
Target Start/End: Complemental strand, 383837 - 383761
Alignment:
Q  556 gcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| |||| ||||||||| ||| ||| || | ||||||||||||||| ||| |||| ||||||||||    
T  383837 gcgtacaatacaccaaattgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgccctt 383761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 473 - 545
Target Start/End: Complemental strand, 14975239 - 14975168
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaaca 545  Q
    |||||||||||||||||||||| || ||||||||   ||||| || || ||||||||||||||||||||||||    
T  14975239 ggtaaagttgttgtcatgtgac-tggaaggtcacggattcaagtcctggaaacagcctcttgtgtaaaaaaca 14975168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 475 - 632
Target Start/End: Complemental strand, 23930283 - 23930128
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaa-tcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaat 573  Q
    ||||| |||||||||||| | | ||||||||| ||||| || || || |||||| ||| ||||||||||||| | ||    |||||||||||||| | ||    
T  23930283 taaagatgttgtcatgtgtc-tcaaaggtcacgagttccaagtcatggaaacagtctcatgtgtaaaaaacaagatagt--tgcgtacaatacaccagat 23930187  T
Q  574 ggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||| ||| | | || | | ||||||||||||||||||||||  |||||||||    
T  23930186 ggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgccctt 23930128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 496 - 632
Target Start/End: Original strand, 17432338 - 17432482
Alignment:
Q  496 tgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaac------agggtaagactgcgtacaatacact--aaatggtgggaccctttc 587  Q
    |||||||||||| |||||| || || ||||| | |||||||||||||||      |||||||| ||| ||||||||||||  |||||||| |||| ||||    
T  17432338 tgaaaggtcacaggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaagggtaaggctgtgtacaatacactaaaaatggtgagaccttttc 17432437  T
Q  588 gcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
     | |  | |  | ||||||||||||||||||||| ||||||||||    
T  17432438 ccggatcctgtgcatgcgggagctttagtgcaccgggttgccctt 17432482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 552 - 641
Target Start/End: Complemental strand, 3116212 - 3116121
Alignment:
Q  552 gactgcgtacaatacactaaa--tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcccttattgttttt 641  Q
    ||||||| ||||||||| |||  ||||||||||| ||| | | |||| ||||||||||||||||||| |||| | |||||||| || |||||    
T  3116212 gactgcgcacaatacaccaaaaatggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgcccttttttttttt 3116121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 473 - 568
Target Start/End: Complemental strand, 2755583 - 2755489
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    |||||||||||||||||||||| |||||||||  | |||||| || || ||||| |||||| |   ||||| ||| |||| |||||||||||||||    
T  2755583 ggtaaagttgttgtcatgtgac-tgaaaggtcgtaggttcaagtcttgcaaacatcctcttataccaaaaataggctaaggctgcgtacaatacac 2755489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 522 - 557
Target Start/End: Complemental strand, 9671196 - 9671161
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgc 557  Q
    ||||||||||||||||||||||||||||||| ||||    
T  9671196 aaacagcctcttgtgtaaaaaacagggtaaggctgc 9671161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 561 - 632
Target Start/End: Original strand, 13267788 - 13267859
Alignment:
Q  561 caatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||| |||||||||||||| |||   | || | ||||||||||||||| |||||||| ||||||||||    
T  13267788 caatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgccctt 13267859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 475 - 583
Target Start/End: Original strand, 32068074 - 32068179
Alignment:
Q  475 taaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaataca-ctaaat 573  Q
    |||||||||||||| |||||  ||||||||||| |||||| || || ||||   ||||||||||||||||||| |||  |||  ||||||||| | ||||    
T  32068074 taaagttgttgtcacgtgacc-gaaaggtcacatgttcaagtcttggaaac---ctcttgtgtaaaaaacaggataatgctgtttacaatacaccaaaat 32068169  T
Q  574 ggtgggaccc 583  Q
    ||||||||||    
T  32068170 ggtgggaccc 32068179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 599 - 641
Target Start/End: Original strand, 6808496 - 6808538
Alignment:
Q  599 gtatgcgggagctttagtgcaccaggttgcccttattgttttt 641  Q
    ||||||||||||||||||||||| |||||||||| || |||||    
T  6808496 gtatgcgggagctttagtgcaccgggttgccctttttcttttt 6808538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0049 (Bit Score: 77; Significance: 4e-35; HSPs: 1)
Name: scaffold0049
Description:

Target: scaffold0049; HSP #1
Raw Score: 77; E-Value: 4e-35
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 58951 - 59113
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac-- 568  Q
    |||||||| || |||||||||||| |||||||||||  |||||| || || |||||||||||||| ||||||||||||||||||||||||||||||||      
T  58951 ctggtaaacttattgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaagactgcgtacaatacacca 59049  T
Q  569 taaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
     |||||||||||||| ||| ||| |  | |||||||||||||||||||||| | ||||||||||    
T  59050 aaaatggtgggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggttgccctt 59113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0258 (Bit Score: 76; Significance: 1e-34; HSPs: 1)
Name: scaffold0258
Description:

Target: scaffold0258; HSP #1
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 473 - 632
Target Start/End: Complemental strand, 13182 - 13025
Alignment:
Q  473 ggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa 572  Q
    |||||||||||||||||||||| |||||||||||  |||||| || || ||||||||||||| ||||||| || |||||| |||||||||||||||  ||    
T  13182 ggtaaagttgttgtcatgtgac-tgaaaggtcaccggttcaagtcctggaaacagcctcttgcgtaaaaa-caaggtaaggctgcgtacaatacaccgaa 13085  T
Q  573 tggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||| ||| ||| || | |||||||||| ||||||||||||| ||||||||||    
T  13084 tggtgggaccccttcccagaccctgcgtatgcgggggctttagtgcaccgggttgccctt 13025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0168 (Bit Score: 75; Significance: 6e-34; HSPs: 1)
Name: scaffold0168
Description:

Target: scaffold0168; HSP #1
Raw Score: 75; E-Value: 6e-34
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 30553 - 30711
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| |||||||||||  |||||| || || ||||||||||||||||||||  ||||||| | ||||||||||||||| |    
T  30553 ctggtaaagttgttgtcatgtgac-tgaaaggtcaccggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtagggctgcgtacaatacacca 30649  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||||| ||| | | || | | |||||||||||| ||||||||| ||||||||||    
T  30650 aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt 30711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 73; Significance: 9e-33; HSPs: 3)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 73; E-Value: 9e-33
Query Start/End: Original strand, 472 - 632
Target Start/End: Original strand, 46806 - 46965
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaa 571  Q
    |||||||||||||||||||||||  ||| ||||||  |||||| |  || ||||| |||||||||||||||| ||||||||  |||||||||||||| ||    
T  46806 tggtaaagttgttgtcatgtgactagaa-ggtcacgggttcaagtgctggaaacaacctcttgtgtaaaaaatagggtaaggttgcgtacaatacaccaa 46904  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    |||||||||||| ||| | | || | |||||||||||||||||||||||| ||||||||||    
T  46905 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt 46965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #2
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 450 - 641
Target Start/End: Complemental strand, 24949 - 24764
Alignment:
Q  450 tgaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggt 549  Q
    ||||||| ||||||| |  | |||||||||||||||||||||||| ||||||||||   |||||| ||     |||||||||||||||||||||||||||    
T  24949 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-tgaaaggtcatgggttcaagtc-----aacagcctcttgtgtaaaaaacagggt 24856  T
Q  550 aagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcccttattgttttt 641  Q
    ||| |||||||||| |||| |||||||||||||| ||| |   || | |||||||||||||||||||||| | |||||||||| || |||||    
T  24855 aaggctgcgtacaacacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcagccggttgcccttttttttttt 24764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #3
Raw Score: 37; E-Value: 0.00000000003
Query Start/End: Original strand, 522 - 620
Target Start/End: Original strand, 43683 - 43780
Alignment:
Q  522 aaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtggga-ccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    ||||||| ||||||||||||  || |||||| ||||||||||||||| ||||||||||| ||||||| | | || | | |||||||||||| ||||||||    
T  43683 aaacagcgtcttgtgtaaaa--caaggtaaggctgcgtacaatacaccaaatggtgggacccctttctcggaccctgcatatgcgggagctctagtgcac 43780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187 (Bit Score: 67; Significance: 3e-29; HSPs: 2)
Name: scaffold0187
Description:

Target: scaffold0187; HSP #1
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 458 - 631
Target Start/End: Complemental strand, 10222 - 10052
Alignment:
Q  458 aaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgc 557  Q
    |||||||||  | |||||||||||||||||||||||| |||||||||||  |||||| || || ||||||||||||||||||||  ||| ||||||||||    
T  10222 aaccttgacgcaactggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagagtaagactgc 10126  T
Q  558 gtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccct 631  Q
    ||||||||||| |||| ||||||||| ||| | | || | | ||||| ||||||  |||||||| |||||||||    
T  10125 gtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct 10052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #2
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 458 - 631
Target Start/End: Complemental strand, 20550 - 20380
Alignment:
Q  458 aaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgc 557  Q
    |||||||||  | |||||||||||||||||||||||| |||||||||||  |||||| || || ||||||||||||||||||||  ||| ||||||||||    
T  20550 aaccttgacgcaactggtaaagttgttgtcatgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagagtaagactgc 20454  T
Q  558 gtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccct 631  Q
    ||||||||||| |||| ||||||||| ||| | | || | | ||||| ||||||  |||||||| |||||||||    
T  20453 gtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct 20380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0311 (Bit Score: 66; Significance: 1e-28; HSPs: 1)
Name: scaffold0311
Description:

Target: scaffold0311; HSP #1
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 471 - 620
Target Start/End: Original strand, 10784 - 10932
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||||||||||||| || ||||||||  ||||||    || ||||| ||||||||||||||||||||||| | |||||| |||||||| |    
T  10784 ctggtaaagttgttgtcatgtgac-tggaaggtcacgggttcaaggtctgaaaacaacctcttgtgtaaaaaacagggtagggctgcgtccaatacacca 10882  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcac 620  Q
    ||||||||||||| ||| | | || | |||||||||||||||||||||||    
T  10883 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac 10932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1176 (Bit Score: 63; Significance: 8e-27; HSPs: 1)
Name: scaffold1176
Description:

Target: scaffold1176; HSP #1
Raw Score: 63; E-Value: 8e-27
Query Start/End: Original strand, 472 - 629
Target Start/End: Complemental strand, 1745 - 1591
Alignment:
Q  472 tggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaa 571  Q
    ||||||||||||||||||||||| ||||||||||   |||||| || || ||||| ||||||||||||||  |||| |||| |||| |||||||||| ||    
T  1745 tggtaaagttgttgtcatgtgac-tgaaaggtcatgggttcaagtcctgaaaacaacctcttgtgtaaaa--caggataaggctgcatacaatacaccaa 1649  T
Q  572 atggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgcc 629  Q
    ||| |||||||| ||| | | ||   ||||||||||||||||||||||||||||||||    
T  1648 atgatgggaccccttcccggacccggcgtatgcgggagctttagtgcaccaggttgcc 1591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 57; Significance: 3e-23; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 57; E-Value: 3e-23
Query Start/End: Original strand, 509 - 632
Target Start/End: Complemental strand, 48756 - 48635
Alignment:
Q  509 gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga 608  Q
    |||||| | ||| ||||||||||||||||||||  ||||||||| ||||||||||||||| |||||||||||||| ||| | | || | | |||||||||    
T  48756 gttcaagtggtggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggga 48659  T
Q  609 gctttagtgcaccaggttgccctt 632  Q
    ||| ||||||||| ||||||||||    
T  48658 gctctagtgcaccgggttgccctt 48635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 55; Significance: 5e-22; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 55; E-Value: 5e-22
Query Start/End: Original strand, 471 - 632
Target Start/End: Original strand, 11106 - 11263
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacta 570  Q
    |||||||||||||| | ||||||| |||||||||||  |||||| || || |||||||||||||||||||| | ||  |||| |||| |||||||||| |    
T  11106 ctggtaaagttgttct-atgtgac-tgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacaaag--taaggctgcttacaatacacca 11201  T
Q  571 aatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||||||| | ||| | | || | | |||||||||||| ||||||||||||||||||||    
T  11202 aatggtgggacaccttcccggaccctgcatatgcgggagctctagtgcaccaggttgccctt 11263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018 (Bit Score: 52; Significance: 3e-20; HSPs: 1)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 529 - 632
Target Start/End: Complemental strand, 72971 - 72868
Alignment:
Q  529 ctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgc 628  Q
    ||||||||||||||||| |||||| |||| |||||||||| ||||||| | |||| ||| | |  | | |||||||||||||||||||||||||||||||    
T  72971 ctcttgtgtaaaaaacacggtaaggctgcctacaatacaccaaatggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcaccaggttgc 72872  T
Q  629 cctt 632  Q
    ||||    
T  72871 cctt 72868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 49; Significance: 2e-18; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 471 - 582
Target Start/End: Complemental strand, 226567 - 226456
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaa-cagggtaagactgcgtacaatacact 569  Q
    |||||||||||||||||||||||| |||||||||||   ||||| || |  |||||||||||||| ||||||| ||||||||| |||| |||||||||      
T  226567 ctggtaaagttgttgtcatgtgac-tgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacagggtaaggctgcatacaatacatc 226469  T
Q  570 aaatggtgggacc 582  Q
    |||||||||||||    
T  226468 aaatggtgggacc 226456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 47; Significance: 3e-17; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 471 - 587
Target Start/End: Complemental strand, 35180 - 35063
Alignment:
Q  471 ctggtaaagttg-ttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaa-aaaacagggtaagactgcgtacaatacac 568  Q
    |||||||||||  |||||||||||| || ||||||||  |||||| || || |||||| |||||||||   ||||||||||||| |||||||||||||||    
T  35180 ctggtaaagtttattgtcatgtgac-tgtaaggtcacgggttcaagtcctgaaaacagtctcttgtgtgtgaaaacagggtaaggctgcgtacaatacac 35082  T
Q  569 taaatggtgggaccctttc 587  Q
     ||||||||||||||||||    
T  35081 caaatggtgggaccctttc 35063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0254 (Bit Score: 43; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold0254
Description:

Target: scaffold0254; HSP #1
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 474 - 568
Target Start/End: Original strand, 4134 - 4227
Alignment:
Q  474 gtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacac 568  Q
    ||||||||||||| ||||||| |||||||||||  |||||| || || ||||| |||||||||||||| ||||| ||||  ||||||||||||||    
T  4134 gtaaagttgttgttatgtgac-tgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacac 4227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0167 (Bit Score: 41; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0167
Description:

Target: scaffold0167; HSP #1
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 509 - 613
Target Start/End: Original strand, 23610 - 23714
Alignment:
Q  509 gttcaaatcgtgtaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcggga 608  Q
    |||||| || || ||||| |||||||||||||||||||||| || |||||||||||  |  |||||||||||||| ||| ||| ||||  ||||| ||||    
T  23610 gttcaagtcttgcaaacaacctcttgtgtaaaaaacagggtgaggctgcgtacaatgtagcaaatggtgggaccccttcccagaccttgagtatgtggga 23709  T
Q  609 gcttt 613  Q
    |||||    
T  23710 gcttt 23714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0180 (Bit Score: 39; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0180
Description:

Target: scaffold0180; HSP #1
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 546 - 632
Target Start/End: Complemental strand, 24220 - 24134
Alignment:
Q  546 gggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcaccaggttgccctt 632  Q
    ||||||| ||||||||||||||| |||||||||||||| ||| | | || | | |||||||||||| ||||||||| | ||||||||    
T  24220 gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccctt 24134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0116 (Bit Score: 38; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0116
Description:

Target: scaffold0116; HSP #1
Raw Score: 38; E-Value: 0.000000000007
Query Start/End: Original strand, 451 - 542
Target Start/End: Original strand, 8848 - 8935
Alignment:
Q  451 gaggggaaaccttgacatagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaa 542  Q
    |||||| |||||||||   ||||||||||||||||||||||||| || ||||||||| |||||| || || ||||| | |||||||||||||    
T  8848 gaggggtaaccttgac---gctggtaaagttgttgtcatgtgac-tgtaaggtcacaggttcaattcctggaaacaacttcttgtgtaaaaa 8935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0028 (Bit Score: 34; Significance: 0.000000002; HSPs: 1)
Name: scaffold0028
Description:

Target: scaffold0028; HSP #1
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 528 - 588
Target Start/End: Original strand, 32960 - 33021
Alignment:
Q  528 cctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaa-tggtgggaccctttcg 588  Q
    |||||| |||||||||||| |||||||||  |||||||||| ||| ||||||||||||||||    
T  32960 cctcttctgtaaaaaacagagtaagactgtatacaatacaccaaattggtgggaccctttcg 33021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0954 (Bit Score: 32; Significance: 0.00000003; HSPs: 1)
Name: scaffold0954
Description:

Target: scaffold0954; HSP #1
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 526 - 621
Target Start/End: Original strand, 3572 - 3667
Alignment:
Q  526 agcctcttgtgtaaaaaacagggtaagactgcgtacaatacactaaatggtgggaccctttcgcagcccttacgtatgcgggagctttagtgcacc 621  Q
    |||||||||||||||| | | |||||| ||||||| |||||||  |||| |||||||| ||| |   || | ||||||||| ||||||||||||||    
T  3572 agcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcacc 3667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031 (Bit Score: 32; Significance: 0.00000003; HSPs: 1)
Name: scaffold0031
Description:

Target: scaffold0031; HSP #1
Raw Score: 32; E-Value: 0.00000003
Query Start/End: Original strand, 471 - 542
Target Start/End: Original strand, 43103 - 43173
Alignment:
Q  471 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaacagcctcttgtgtaaaaa 542  Q
    ||||||||||| |||||||||||  ||||||||||| ||||||  || |  |||||||||||||||||||||    
T  43103 ctggtaaagttattgtcatgtgat-tgaaaggtcacgagttcaggtcctagaaacagcctcttgtgtaaaaa 43173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University