View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5590_high_6 (Length: 392)
Name: NF5590_high_6
Description: NF5590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5590_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 10 - 375
Target Start/End: Complemental strand, 48255492 - 48255127
Alignment:
| Q |
10 |
aagaatataaatattaactctatcaactgctgtctctgtatatcttggtatgtgatgtcattcaccatgattagagacataatttaatggttgagagcta |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48255492 |
aagaaaataaatattaactctatcaactgctatctctgtatatcttggtatgtgatgtcattcaccatgattagagacataatttaatggttgagagcta |
48255393 |
T |
 |
| Q |
110 |
tatataatttattaaacaatcaaacatttttatttatttgattctggcagctcaagctattggaattccatttttgagtccatatctacaatcaatagga |
209 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48255392 |
tatatcatttattaaacaatcaaacatttatatttatttgattctggcagctcaagctattggaattccatttttgagtccatatctacaatcaatagga |
48255293 |
T |
 |
| Q |
210 |
tcttattataaacatggagccaactatgctacattggcatccactgtgcttctacctaatacttctttgtttgtcactgggatcagccctttctcccttg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48255292 |
tcttattataaacatggagccaactatgctacattggcatccactgtgcttctacctaatacttctttgtttgtcactgggatcagccctttctcccttg |
48255193 |
T |
 |
| Q |
310 |
ctattcagctcaaccaaatgaaacaatttgcaaccaaagttaaagaagctgatcaacaaggtacat |
375 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48255192 |
ctattcagctcacccaaatgaaacaatttgcaaccaaagttaaagaagctgatcaacaaggtacat |
48255127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University