View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5590_low_13 (Length: 267)
Name: NF5590_low_13
Description: NF5590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5590_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 10 - 249
Target Start/End: Complemental strand, 8827345 - 8827106
Alignment:
| Q |
10 |
aagaatattaacctagctgtcttttttcttcttgtagtcggtttgatactatgatcgcttttggtttacctgatcaacaaactcgtcaggaaatagcatc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8827345 |
aagaatattaacctagctgtcttttttcttcttgtagtcggtttgatactatgatcgcttttggtttacctgatcaacaaactcgtcaggaaatagcatc |
8827246 |
T |
 |
| Q |
110 |
taaatatgcaaagcacctgtctaaagccgaacttgatgaacttgcaagagttgcagaagagtaagtttgactaactattgagtttcccaccagagttatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8827245 |
taaatatgcaaagcacctgtctaaagccgaacttgatgaacttgcaagagttgcagaagagtaagtttgactaattattgagtttcccaccagagttatt |
8827146 |
T |
 |
| Q |
210 |
catgagtagaatatgcagaaagtatatagatagacgtgtt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8827145 |
catgagtagaatatgcagaaagtatatagatagacgtgtt |
8827106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University