View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5590_low_15 (Length: 252)
Name: NF5590_low_15
Description: NF5590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5590_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 8047665 - 8047902
Alignment:
| Q |
1 |
ccaaaattacttttaagtcatcatagtattaaagtgataaattaatttatactttttaataactataaaatgcagggaataatcaagtttgcaagtgata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8047665 |
ccaaaattacttttaagtcatcatagtattaaagtgataaattaatttatactttttaataactataaaatgcaaggaataatcaagtttgcaagtgata |
8047764 |
T |
|
| Q |
101 |
caagagagggttttttggacttagaaacatatacaaatcctaaatcaaaatcttttgaataacatactaaggtctatccaaatcatctagagacgattga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8047765 |
caagagagggttttttggacttagaaacatatacaagtcctaaatcaaaatcttttgaataacgtactaaggtctatccaaatcatccagagacgattga |
8047864 |
T |
|
| Q |
201 |
tgaattgattattgcggtataaaaaataagtatttaga |
238 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8047865 |
tgaattgattcttgcggtataaaaaataagtatttaga |
8047902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University