View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5591_high_4 (Length: 386)
Name: NF5591_high_4
Description: NF5591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5591_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 181 - 378
Target Start/End: Complemental strand, 36967892 - 36967695
Alignment:
| Q |
181 |
atcaactatgctcatctgttttcattcatattcctatatttcttctctcaatcccaccttttaatctctcccaaccatttcccactttaaccgctttcaa |
280 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36967892 |
atcaactatgctcatatgttttcattcatattcctatatttcttctctcaatcccaccttttaatctctcccaaccatttcccactttaaccgctttcaa |
36967793 |
T |
|
| Q |
281 |
aagtactctctcatttatcataaaccctattcttctttctcctcctgctccggcccatcatgaggtagcctctcaaatgcctcgccggcgttcttctc |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36967792 |
aagtactctctcatttatcataaaccctattcttctttctcctcctgctccggcccatcatgaggtagcctctcaaatgcctcgccggcgttcttctc |
36967695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 18 - 98
Target Start/End: Complemental strand, 36968047 - 36967964
Alignment:
| Q |
18 |
ataatgagatgcgacatataaaataacttaatggatatgttttaaactaa---aaaatactatttatgtatggatttcggtgcc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
36968047 |
ataatgagatgcgacatataaaataacttaatgggtaggttttaaactaaaaaaaaatactctttatgtatggatttcggtgcc |
36967964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University