View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5591_high_9 (Length: 323)
Name: NF5591_high_9
Description: NF5591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5591_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 20 - 155
Target Start/End: Complemental strand, 5361417 - 5361279
Alignment:
| Q |
20 |
actagcattgttattaggttaaatttcatggacaaacaagaaaacttaacacacagttttgaagataaaca---nnnnnnnnatcttgacttgtttccgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5361417 |
actagcattgttattaggttaaatttcatggacaaacaagaaaacttaacacacagttttgaagataaacattttttttgttatcttgacttgtttccgt |
5361318 |
T |
 |
| Q |
117 |
gtgtatgtgttttctctttatttattacttaacactcag |
155 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
5361317 |
gtgtatgtgttttctctgtatttaatacttaacactcag |
5361279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 222 - 313
Target Start/End: Complemental strand, 5361209 - 5361121
Alignment:
| Q |
222 |
gagacaacactggtggagacacgaaaacaacataagaggcaaaataaggactaccaaattcaagacaggatcactgacttgtctgatgatgt |
313 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |||||||| |
|
|
| T |
5361209 |
gagacaacactggttgagacacgaaaacaacataagaggcaaaataaggactaccaaattcaagacag---cagtgacttgtccgatgatgt |
5361121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University