View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5591_low_14 (Length: 252)
Name: NF5591_low_14
Description: NF5591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5591_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 134 - 240
Target Start/End: Complemental strand, 9879821 - 9879715
Alignment:
| Q |
134 |
atatacgttatttagcatgcaaaatcaatctacaacgtaaaactgattgaaaattgaaagcaagaaaataaagaaaacgtgattagtactctgacagcag |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9879821 |
atatacgttatttagcatgcaaaatcaatctacaacataaaactgattgaaaattgaaagcaagaaaataaagaaaacgtgattagtactctgacagcag |
9879722 |
T |
 |
| Q |
234 |
ttgatga |
240 |
Q |
| |
|
||||||| |
|
|
| T |
9879721 |
ttgatga |
9879715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 144
Target Start/End: Complemental strand, 9879875 - 9879836
Alignment:
| Q |
105 |
gacataatcaagaatatgtgattatcaagatatacgttat |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9879875 |
gacataatcaagaatatgtgattatcaagatatacgttat |
9879836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University