View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5592_high_4 (Length: 238)
Name: NF5592_high_4
Description: NF5592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5592_high_4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 30726918 - 30727136
Alignment:
| Q |
18 |
agttataggatataaaactggtggaagaagctttatataatgagaaaaatagctagaaagggaactgagttaattaacatagtggtgtctattttttaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30726918 |
agttataggatataaaactggtggaagaagctttatataatgagaaaaatagctagaaagggaactgagttaattaacatagtggtgtctattttttaac |
30727017 |
T |
|
| Q |
118 |
tagggttgcatttgtatttgcatgtccttgtagttctatttgaaagcaacttaaaagaaaatatgagagaagagagnnnnnnnnggtagctggaaaagta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
30727018 |
tagggttgcatttgtatttgcatgtccttgtagttctatttgaaagcaacttaaaagaaaatatgagag--gagagaaaaaaaaggtagctggaaaagta |
30727115 |
T |
|
| Q |
218 |
ttgttataaggtagcttctgt |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30727116 |
ttgttataaggtagcttctgt |
30727136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University