View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5594_high_11 (Length: 253)
Name: NF5594_high_11
Description: NF5594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5594_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 53046444 - 53046202
Alignment:
| Q |
1 |
tcttggtcatcagaatttgtaagatttccataccatgtaaaaacaacagactcactctgaagtatgtagcaataagaggaattcaaggcggaagcagcct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
53046444 |
tcttggtcatcagaatttgtaagatttccataccatgtaaaaacaacggactcactctgaagtatgtagcaataagaggaattcaaggaggaagcagcct |
53046345 |
T |
|
| Q |
101 |
ggttgacgaagacaatgaaaagaaaaattgtgattatttttattttattataaattgcccatacaaaatgaggggctagaatggccactacaaacagaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53046344 |
ggttgacgaagacaatgaaaagaaaaattgtgattatttttattttattataaattgcccatacaaaatgaggggctagaatggccactacaaacagaca |
53046245 |
T |
|
| Q |
201 |
agatgacatactgagttaacttgtatagcttgcatactctctg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53046244 |
agatgacatactgagttaacttgtatagcttgcatactctctg |
53046202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 58 - 107
Target Start/End: Original strand, 15960771 - 15960820
Alignment:
| Q |
58 |
tgaagtatgtagcaataagaggaattcaaggcggaagcagcctggttgac |
107 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
15960771 |
tgaagtatatagcaataagaggaattcaaggaagaagcaacctggttgac |
15960820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University