View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5594_high_3 (Length: 509)
Name: NF5594_high_3
Description: NF5594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5594_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 499; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 499; E-Value: 0
Query Start/End: Original strand, 1 - 499
Target Start/End: Original strand, 40080030 - 40080528
Alignment:
| Q |
1 |
ggtattggacgcaacaaaactttcatgcacacggttttcccttcatggagcactcccatacttgaatcagtagctagcattggccttctcttctatctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40080030 |
ggtattggacgcaacaaaactttcatgcacacggttttcccttcatggagcactcccatacttgaatcagtagctagcattggccttctcttctatctct |
40080129 |
T |
 |
| Q |
101 |
tcctcgtaggtcttgagctcgacctccgcaccattaaccgcagtggtaagcgagctttcaacatcgctgtcgcaggaatatccctcccattcctcttcgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40080130 |
tcctcgtaggtcttgagctcgacctccgcaccattaaccgcagtggtaagcgagctttcaacatcgctgtcgcaggaatatccctcccattcctcttcgc |
40080229 |
T |
 |
| Q |
201 |
catcggagtaaccttccttctccaaaaagtcatccatttcaactctgaaactcacaaagtcagttactttcaactcttcatattcttaggcgtatctctc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40080230 |
catcggagtaaccttccttctccaaaaagtcatccatttcaactctgaaactcacaaagtcagttactttcaactcttcatattcttaggcgtatctctc |
40080329 |
T |
 |
| Q |
301 |
tccatcactgctttccctgtactcgcacgcatcttagcagagcttaaattgttaacaacacaagtaggagaaactgccatggccgcagctgcttttaacg |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40080330 |
tccatcactgctttccctgtactcgcacgcatcttagcagagcttaaattgttaacaacacaagtaggagaaactgccatggccgcagctgcttttaacg |
40080429 |
T |
 |
| Q |
401 |
acgttgctgcatgggttttattagcactggccattgctttagccggtggtggagaacatagaaacggtgtcttgacatccatcttagtactactctctg |
499 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40080430 |
acgttgctgcatgggttttattagcactggccattgctttagccggtggtggagaacatagaaacggtgtcttgacatccatcttagtactactctctg |
40080528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University