View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5594_high_6 (Length: 386)
Name: NF5594_high_6
Description: NF5594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5594_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 1e-44; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 130 - 245
Target Start/End: Complemental strand, 22562764 - 22562649
Alignment:
| Q |
130 |
tctcggctgcttgaatgattttttaattgttgttgtccctcacggctattttgttctgcagcccacctataaacacttgtggtggtgggttgaagccaat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
22562764 |
tctcggctgcttgaatgattttttaattggtgttgtccctggcggctattttgatctgcagcccgcctataaacacttgcggtggtgggttgaagccaat |
22562665 |
T |
|
| Q |
230 |
aaaaatttaggcgatt |
245 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
22562664 |
aaaaatttaggcgatt |
22562649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 276 - 366
Target Start/End: Complemental strand, 22562436 - 22562346
Alignment:
| Q |
276 |
ttacgtacacctctagaactaggcgtgccgccgtgtccgacatgcgttgatgtccaatacttctatgacacctcaagaactaggcgtgtca |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| ||| |||||||||||| |
|
|
| T |
22562436 |
ttacgtacacctctagaactaggcgtgccgccgtgtccgacatgcgttgatgtccgacacttctatgacacctctagagctaggcgtgtca |
22562346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 63 - 122
Target Start/End: Complemental strand, 22562885 - 22562826
Alignment:
| Q |
63 |
gctgcgtaattttgcaggtttttgagaacatttattcggcataatggctgaagttttcgg |
122 |
Q |
| |
|
||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22562885 |
gctgcataattttgtaggtttttgagaacatttcttcggcataatggctgaagttttcgg |
22562826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 343
Target Start/End: Original strand, 34409326 - 34409386
Alignment:
| Q |
283 |
cacctctagaactaggcgtgccgccgtgtccgacatgcgttgatgtccaatacttctatga |
343 |
Q |
| |
|
||||||||| |||||||||| ||| ||||| |||| |||||||||||| | ||| |||||| |
|
|
| T |
34409326 |
cacctctaggactaggcgtgtcgcggtgtcggacacgcgttgatgtccgacactcctatga |
34409386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University