View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5594_low_12 (Length: 244)
Name: NF5594_low_12
Description: NF5594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5594_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 53046650 - 53046874
Alignment:
| Q |
1 |
acttgtataagtgtttgaaaaaacatgtaaaaaagagattatgaatccccaagataacttgttattgccaaacttgccattggactatatggaattgcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53046650 |
acttgtataagtgtttgaaaaaacatgtaaaaaagagattatgaatccccaagataacttgttattgccaaacttgccattggactatatggaattgcct |
53046749 |
T |
|
| Q |
101 |
cagttttccagtgccttggttttgatcccagaaggcattatttttcccaagccacattacccagcccagaaattatgcaaaaatataactgtatctttat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53046750 |
cagttttccagtgccttggttttgatcccagaaggcatta-ttttcccaagccacattacccagcccagaaattatgcaaaaatataactgtgtctttat |
53046848 |
T |
|
| Q |
201 |
caacacatatgcttgccaattgtctg |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
53046849 |
caacacatatgcttgccaattgtctg |
53046874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University