View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5594_low_15 (Length: 229)
Name: NF5594_low_15
Description: NF5594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5594_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 18 - 86
Target Start/End: Complemental strand, 20377067 - 20376999
Alignment:
| Q |
18 |
atgagaagcgtggaaggggacgtcctcgtggttctggaaaattgcaaattttggcttccattggtatga |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20377067 |
atgagaagcgtggaaggggacgtcctcgtggttctggaaaattgcaaattttggcttccattggtatga |
20376999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 20 - 86
Target Start/End: Complemental strand, 20369136 - 20369070
Alignment:
| Q |
20 |
gagaagcgtggaaggggacgtcctcgtggttctggaaaattgcaaattttggcttccattggtatga |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20369136 |
gagaagcgtggaaggggacgtcctcgtggttctggaaaattgcaaattttggcttccattggtatga |
20369070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 20 - 86
Target Start/End: Complemental strand, 20389437 - 20389371
Alignment:
| Q |
20 |
gagaagcgtggaaggggacgtcctcgtggttctggaaaattgcaaattttggcttccattggtatga |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20389437 |
gagaagcgtggaaggggacgtcctcgtggttctggaaaattgcaaattttggcttccattggtatga |
20389371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 162 - 216
Target Start/End: Complemental strand, 20376923 - 20376869
Alignment:
| Q |
162 |
atattgcttggttgagaagggtttgttttttacacttgaaacttgttgaaatgat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20376923 |
atattgcttggttgagaagggtttgttttttacacttgaaacttgttgaaatgat |
20376869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 20 - 86
Target Start/End: Complemental strand, 20347740 - 20347674
Alignment:
| Q |
20 |
gagaagcgtggaaggggacgtcctcgtggttctggaaaattgcaaattttggcttccattggtatga |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| | ||||||| |||||||||||| |
|
|
| T |
20347740 |
gagaagcgtggaaggggacgtcctcgtggttctggaaaactgcagagtttggctcccattggtatga |
20347674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 216
Target Start/End: Complemental strand, 20368975 - 20368923
Alignment:
| Q |
162 |
atattgcttggttgagaagggtttgttttttacacttgaaacttgttgaaatgat |
216 |
Q |
| |
|
|||||| |||||||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
20368975 |
atattgtttggttgaaaagg--ttcttttttacacttgaaacttgttgaaatgat |
20368923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University