View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5595-Insertion-12 (Length: 263)
Name: NF5595-Insertion-12
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5595-Insertion-12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-141; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 8 - 260
Target Start/End: Complemental strand, 7260295 - 7260043
Alignment:
| Q |
8 |
accttgtgtcacaacaagaagttcactggcaccagggtgagtgtgaagtgggataacaccagcaggaccaaggtctaaccttgctgcagagagaccaaga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7260295 |
accttgtgtcacaacaagaagttcactggcaccagggtgagtgtgaagtgggataacaccagcaggaccaaggtctaaccttgctgcagagagaccaaga |
7260196 |
T |
|
| Q |
108 |
ccattaacagctggaaattgagcaacaaatgcaggtgtaacggcggcgttgataatgtttgttatgtttccaggtgcaattaagccttcaaatgcaaagt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7260195 |
ccattaacagctggaaattgagcaacaaatgcaggtgtaacggcggcgttgataatgtttgttatgtttccaggtgcaattaagccttcaaatgcaaagt |
7260096 |
T |
|
| Q |
208 |
catctgaggttactgttgaagctggcttgcaagggtagcctgaaggagtgtct |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7260095 |
catctgaggttactgttgaagctggcttgcaagggtagcctgaaggagtgtct |
7260043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 78 - 142
Target Start/End: Complemental strand, 7266052 - 7265988
Alignment:
| Q |
78 |
aggtctaaccttgctgcagagagaccaagaccattaacagctggaaattgagcaacaaatgcagg |
142 |
Q |
| |
|
|||||||| ||||||| || | |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7266052 |
aggtctaattttgctgctgataaaccaagaccattaacagctggaaattgattaacaaatgcagg |
7265988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University