View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5595-Insertion-16 (Length: 210)
Name: NF5595-Insertion-16
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5595-Insertion-16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 8 - 209
Target Start/End: Original strand, 30088288 - 30088489
Alignment:
| Q |
8 |
atctggtcctgtaccttctggccttggagatttgcctcaactagaggtgcttgagctatggaacaattctttgtcagggccattgcctagagacctcggc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30088288 |
atctggtcctgtaccttctggccttggagatttgcctcaactagaggtgcttgagctatggaacaattctttgtcagggccattgcctagagacctcggc |
30088387 |
T |
|
| Q |
108 |
aagaattcgccgctgcagtggttggatgtatcgtccaattcactctccggcgagattcctgaaactctttgcactaagggaaatctcaccaagcttatac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30088388 |
aagaattcgccgctgcagtggttggatgtatcgtccaattcactctccggcgagattcctgaaactctttgcactaagggaaatctcaccaagcttatac |
30088487 |
T |
|
| Q |
208 |
tt |
209 |
Q |
| |
|
|| |
|
|
| T |
30088488 |
tt |
30088489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 8 - 209
Target Start/End: Complemental strand, 39469663 - 39469462
Alignment:
| Q |
8 |
atctggtcctgtaccttctggccttggagatttgcctcaactagaggtgcttgagctatggaacaattctttgtcagggccattgcctagagacctcggc |
107 |
Q |
| |
|
||||||| ||| |||||||| |||||| ||||||||||| | ||||| ||||||||||||||||||| || ||||| ||||||||||| |||||||| |
|
|
| T |
39469663 |
atctggttttgttccttctggacttggaaatttgcctcaattggaggtttttgagctatggaacaattcattatcaggtccattgcctagtaacctcggc |
39469564 |
T |
|
| Q |
108 |
aagaattcgccgctgcagtggttggatgtatcgtccaattcactctccggcgagattcctgaaactctttgcactaagggaaatctcaccaagcttatac |
207 |
Q |
| |
|
||||||| || |||| |||||||||||||| |||||||||||||| || |||||||| ||||||||||||| ||||| ||||| |||||||| |||| |
|
|
| T |
39469563 |
gagaattcaccattgcaatggttggatgtatcatccaattcactctctggagagattccagaaactctttgcagcaagggcaatcttaccaagctaatac |
39469464 |
T |
|
| Q |
208 |
tt |
209 |
Q |
| |
|
|| |
|
|
| T |
39469463 |
tt |
39469462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University