View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5595_high_16 (Length: 432)
Name: NF5595_high_16
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5595_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 6e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 49 - 215
Target Start/End: Complemental strand, 31613590 - 31613424
Alignment:
| Q |
49 |
caaaattgaaatctaaacaaataaaccaaaccagcagcagtaagtaaagaaaggagacattagtttgcaagcatgttcatacactagatgttgcagaagt |
148 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31613590 |
caaaattgaaatctaaacaattaaaccaaaccagcagcagtaagtaaagaaaggagacattagtttgcaagcatgttcatacactagatgttgcagaagt |
31613491 |
T |
|
| Q |
149 |
gaccttttgccctgcctccattccagttaatgtatcatagagtggttggtttagtgtctctggcaag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31613490 |
gaccttttgccctgcctccattccagttaatgtatcatagagtggttggtttagtgtctctggcaag |
31613424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 267 - 432
Target Start/End: Complemental strand, 31613372 - 31613207
Alignment:
| Q |
267 |
ggcaatgatccacccaaaacgacaacaactggggccaatattgcacccatttgtgctgcttgtgtagcacacccaagtgcagcattcctaacaaccgttg |
366 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31613372 |
ggcaatgatccacctaaaacgacaacaactggtgccaatattgcacccatttgtgctgcttgtgtagcacacccaagtgcagcattcctaacaaccgttg |
31613273 |
T |
|
| Q |
367 |
ggaacaactccgctgcataaataaagagcaaattataagtccctgccatcccaaatattcccaaaa |
432 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31613272 |
ggaacaactccgccgtataaataaagagcaaattataagtccctgccatcccaaatattcccaaaa |
31613207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University