View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5595_high_43 (Length: 251)
Name: NF5595_high_43
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5595_high_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 8925774 - 8925533
Alignment:
| Q |
1 |
tgatgcctataaatgactggatttagttttgcttatattaatttattttatgtgatttttatcatttcaaaatataaaattgttgttgttcataaa--ca |
98 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
8925774 |
tgatgcctataaatgactggattttgttttgcttatattaatttattttatgtgatttttatcatttcaaaatataaaattgttgttgtccataaaaaca |
8925675 |
T |
 |
| Q |
99 |
attataaagaaacaaataatgttttttattataaaatatatcatgcaattcattaatcatattaaatattttttccacctatgtagtccaacttaactaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8925674 |
attataaagaaacaaataatgttttttattataaaatatatcatgcaatacattaatcatattaaatattttttccacctatgtagtccgacttaactaa |
8925575 |
T |
 |
| Q |
199 |
agagataagtctttgtaattgtccgcatgtcatccagttcat |
240 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8925574 |
agagataagtctttgtagttgtccgcatgtcatccagttcat |
8925533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University