View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5595_high_45 (Length: 248)
Name: NF5595_high_45
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5595_high_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 8925947 - 8926065
Alignment:
| Q |
1 |
tttccattcttaaccattccttcaagttggatgcctataaatacattacattgcaccttaagaatcgcactcctcacagcatatactctctcattcatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
8925947 |
tttccattcttaaccattccttcaagttggatgcctataaatacattacattgcaccttaagaatcgcactcctcacagcatata--ctctcattcacat |
8926044 |
T |
|
| Q |
101 |
atagctgaatattgaagtgag |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8926045 |
atagctgaatattgaagtgag |
8926065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 169 - 229
Target Start/End: Original strand, 8926113 - 8926173
Alignment:
| Q |
169 |
ctttccagttgttgacatggggaagcttaacacagaagagagaaaagctaccatggagatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8926113 |
ctttccagttgttgacatggggaagcttaacacagaagagagaaaagctaccatggagatg |
8926173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University